Robinia pseudoacacia

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Robinia

At a glance

Occurrence records460 094

Data sources17

Biological traits157

DNA specimens53

eDNA detections429

Sources17 archives

Databases and archives Robinia pseudoacacia's data was compiled from.

WikipediaWikimedia Foundation17 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility460 094 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI429 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements6 literature sources157 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS195 compounds

Occurrence & distributionGBIF460 094 records

Environmental DNA3 datasets · 13 countries429 detections

DNA & barcodingBOLD · NCBI53 specimens

Genome at a glanceCCDB · GoaT773 Mbp

01Narrative

Robinia pseudoacacia, commonly known in its native territory as black locust, is a medium-sized hardwood deciduous tree, belonging to the tribe Robinieae of the legume family Fabaceae. It is endemic to a few small areas of the United States, but it has been widely planted and naturalized elsewhere in temperate North America, Europe, Southern Africa and Asia and is considered an invasive species in some areas. Another common name is false acacia, a literal translation of the specific name (pseudo [Greek ψευδο-] meaning fake or false and acacia referring to the genus of plants with the same name).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTAusTraitsLEDAUSDATRYWCVP

Size & morphology26

Fruit length80 mm

⚠ sources differ — AusTraits: 80 mm · GIFT: 58 mm

Fruit length max100 mm

Fruit length min35 mm

Fruit width13 mm

Fruit width max20 mm

Fruit width min10 mm

Inflorescence length max20 cm

Leaf length50 mm

Leaf length max150 mm

Leaf length min20 mm

Leaf size1 125 mm²

⚠ sources differ — TRY: 1 125 mm² · LEDA: 962 mm² · GIFT: 962 mm²

Leaf width17.5 mm

Leaf width max30 mm

Leaf width min2 mm

Petiole length3 cm

Plant height19.32 m

⚠ sources differ — GIFT: 19.32 m · AusTraits: 16 m · LEDA: 20 m · USDA: 16.76 m · TRY: 17.5 m

Plant height generative6.5 m

Plant height max35 m

Plant height min1.5 m

Seed length5.5 mm

⚠ sources differ — TRY: 5.5 mm · AusTraits: 5 mm

Seed mass18.88 mg

Seed mass max26.45 mg

Seed mass min15.84 mg

Seed volume20 mm³

Seed volume max20 mm³

Seed volume min20 mm³

Life cycle & reproduction37

Bloom periodLate Spring

Coppice potentialYes

Deciduousnessdeciduous

Dehiscencedehiscent

Dispersal typeanimal

⚠ sources differ — LEDA: endozoochor · GIFT: autochorous

Flower colourwhite

Flower conspicuousNo

Flowering endJun

Flowering startMay

Flowering timennnnnnnnyyyn

Fruit seed period beginSpring

Fruit seed period endFall

Growth rate USDARapid

Life formshrub or tree

Life spanperennial

Lifespan categoryShort

Lifespan years96 years

Pollination modebiotic

Pollination syndromeinsect

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsYes

Propagated by seedNo

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Raunkiær life formphanerophyte

Reproduction asexualabsent

Resprout abilityYes

Resprouting capacityresprouts

Seed spread rateModerate

Seedling vigorHigh

Self fertilizationabsent

Sex typehermaphrodite

Vegetative spread rateModerate

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment33

Active growth periodSpring

Adapted to coarse textured soilsYes

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Elevation max2 300 m

Elevation min0 m

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureCoarse

Fruit colourblack

Fruit fleshinessdry

Fruit typelegume

Growth formtree

Growth form USDAMultiple Stem

Habitat GIFTLowland

Hedge toleranceLow

Known allelopathNo

Leaf compoundnesscompound

Leaf formelliptic

Leaf retentionNo

Leaf shapeoblong obovate

Low growing grassNo

Mycorrhiza typearbuscular

Root depth min36 in

Shape and orientationErect

Small grainNo

Woodinesswoody

Physiology & chemistry29

Anaerobic toleranceLow

C:N ratioHigh

Caco3 toleranceHigh

Cold stratification requiredNo

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceHigh

Frost free days min140 days

Leaf C:N ratio11.22 g/g

Leaf c475 mg/g

Leaf dry-matter content (LDMC)335 mg/g

⚠ sources differ — TRY: 335 mg/g · LEDA: 248 mg/g

Leaf n36.97 mg/g

Leaf p1.85 mg/g

Moisture useMedium

Nitrogen fixation levelMedium

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Precipitation max62.5 in

Precipitation min18 in

Protein potentialLow

Salinity toleranceMedium

Seed longevity index0.5

Shade toleranceHigh

Soil pH max7.85 pH

Soil pH min4.7 pH

Specific leaf area (SLA)24.13 mm²/mg

⚠ sources differ — TRY: 24.13 mm²/mg · LEDA: 15.5 mm²/mg · GIFT: 17.9 mm²/mg

Temperature min-37 °F

Wood density688 mg/cm³

⚠ sources differ — TRY: 688 mg/cm³ · GIFT: 767 mg/cm³

Uses & economy16

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityRoutinely Available

Fodder productNo

Fuelwood productHigh

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalLow

Palatable graze animalLow

Palatable humanNo

Post productYes

Pulpwood productYes

Seeds per pound24 000 per lb

ToxicityNone

Veneer productNo

Other traits14

Defenseyes

Diaspore typeseed

Fall conspicuousNo

Fruit seed abundanceMedium

Fruit seed conspicuousYes

Fruit seed persistenceYes

Height at 20yr12.19 m

Inflorescenceraceme

Leaf marginentire

Leaf spinesno

Leaf thornsno

Planting density max1 200 per acre

Planting density min160 per acre

Seeds per fruit>1000

03Chemical composition195 compounds

Compounds documented for Robinia pseudoacacia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking💊 Medicinal use documented

Compound class profile5 classes

Oleanane triterpenoids13

Flavones11

Chalcones10

Aspidosperma type7

Flavanones6

Documented compounds195 total

Compound	Amount	Source
CARBOHYDRATES	466,000 ppm	DukesPhytochem
ALPHA-CELLULOSE	453,000 ppm	DukesPhytochem
PROTEIN	432,000 ppm	DukesPhytochem
FIBER	390,000 ppm	DukesPhytochem
LIGNIN	216,000 ppm	DukesPhytochem
PENTOSANS	191,000 ppm	DukesPhytochem
DIHYDROROBINETIN	176,000 ppm	DukesPhytochem

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Robinia pseudoacacia has left across the world's sequence archives.

At a glance

DNA specimens53

Marker genes8

GenBank sequences9

eDNA detections429

Countries13

The DNA barcodea real sequence read deposited for this species

ITSOR234970.1 ↗355 bp

ACGT

GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCCAAT …

Robinia pseudoacacia isolate G37 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5PmatKrbcL4rbcLaITS5ITS2rpoC1trnH-psbA

animal barcodeplant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Robinia pseudoacacia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size772 620 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Robinia pseudoacacia0.77 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records20–222n range22median22mode33records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2224×CCDB · slov-fl · CCDB · iber-fl · CCDB · ipcn-api-dl +6

CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.

CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).

CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).

CCDB · ipcn-api-dl — Zhu, B. c., H. c. Zheng, S. z. Zheng & Y. Zhang. 1989. Chromosome observation of eight fabaceous species from northwest China. Pp. 369--373 in D. Hong (editor), Plant Chromosome Research 1987.

CCDB · ipcn-api-dl — Zhao, Z. f., Y. q. Wang & S. f. Huang. 1990. Plant chromosome counts (V). Forest Res. (China) 3: 503–508.

CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.

CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.

CCDB · ipcn-api-dl — Mehra, P. N. 1976. Cytology of Himalayan Hardwoods. Sree Saraswaty Press, Calcutta.

CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.

CCDB · ipcn-api-dl — Kodama, A. 1977. Karyological and morphological observations on root nodules of some woody and herbaceous leguminous plants. Bull. Hiroshima Agric. Coll. 5: 389–394.

CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.

CCDB · ipcn-api-dl — Liu, B. 2005. Karyotype analysis and physical mapping of 455 rDNA in eight species of Sophora, Robinia and Amorpha. Acta Bot. Yunnan. 27(3): 261–268.

CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.

CCDB · book-ipcn75-78 — Fernandes & Queiros 1978

CCDB · book-ipcn75-78 — Mehra 1976

CCDB · book-ipcn75-78 — Kodama 1977

CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.

CCDB · book-indian_vol1 — Tschechow, W.P (Fedorov); Majo- vsky, J. et al. 1970b

CCDB · CromoCat 2015 — Fernandes, A., Santos, M. F. & Queirós, M. (1977a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 51: 137-186.

CCDB · CromoCat 2015 — Javurková, V. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 856-857.

CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.

CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.

CCDB · iapt — IAPT/IOPB Chromosome Data 32

2n 209×GoaT · Kew Plant DNA C-values Database · CCDB · nw-europe-fl · CCDB · poland +5

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2853

CCDB · poland — Pogan E., Wcis?o H., Jankun A. et al. 1980 b. Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov. Ser. Bot. 22, 37-69.

CCDB · ipcn-api-dl — Hu, Q. J. & Y. R. Han. 1985. Study of the regenerated plantlet induced from the mature leaf of Robinia pseudoacacia L. Hereditas (Beijing) 7(4): 20–21.

CCDB · book-indian_vol1 — Whitaker, T.W. (Fedorov) ; Wans- cher, J.H. 1934b

CCDB · book-fedorov — Whitaker 1934b

CCDB · book-fedorov — Wanscher 1934b 22 qeXOB 1930

CCDB · book-atlas-flowering-plants — Kreuter 1930

CCDB · kew — Olszewska MJ, Osiecka R. 1984 Relationship between 2C DNA content, systematic position & level of DNA endoreplication during differentiation of root parenchyma in dicot shrubs & trees-comparison with herbaceous sp. Biochem Physiol Pflanzen 179: 641-657

n 113×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · Cannon, 2015

CCDB · ipcn-api-dl — Mehra, P. N. 1976. Cytology of Himalayan Hardwoods. Sree Saraswaty Press, Calcutta.

CCDB · book-ipcn75-78 — Mehra 1976

CCDB · Cannon, 2015 — Zhu,/B.-c., H.-c. Zheng, S.-z. Zheng & Y. Zhang, 1989

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~8.1 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin8.1 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Dietphotoautotroph

08Occurrence & distribution

Record type460 094 records

Wild obs. + sensor383 448

Museum / vouchered11 672

Cultivated / captive63 498

Other1 476

Origin

Native19

Introduced6 793

Range

Area of Occupancy AOO420 432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 113 162≤1 km 32 794≤10 km 141 450>10 km 2 862

290 268 georeferenced · 93 180 without coordinates

Open the mapobservation + sensor383 448

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 597≤1 km 1 290≤10 km 2 706>10 km 177

4 770 georeferenced · 6 902 without coordinates

Open the institutions mapphysical evidence11 672

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy96% within 1 km

≤100 m 92≤1 km 4≤10 km 3>10 km 1

100 georeferenced · 63 398 without coordinates

Open the mapnot free-living63 498

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions253 of 443 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	2 941
Uniwersytet Wrocławskilocation not on record	1 700
Philadelphia, US	250
BFLlocation not on record	207
Chongqing Museumlocation not on record	188
Uniwersytet Warszawskilocation not on record	159
Odawara, JP	155
Wuzhou, CN	142
Bronx, US	128
Madison, US	121
Karlsruhe, DE	119
College Park, US	99
Görlitz, DE	87
Nagano City, JP	80
LDlocation not on record	76
Bloomington, US	70
Moscow State Universitylocation not on record	67
Claremont, US	66
Toronto, CA	65
SLU Artdatabankenlocation not on record	64
Bangkok, TH	57
Uniwersytet Opolskilocation not on record	56
Allentown, US	51
Museo Entomologico de Leonlocation not on record	51
Millersville, US	49
Williamsburg, US	49
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	48
University of Stellenboschlocation not on record	48
Yangling, CN	47
St. Paul, US	46
Jena Microbial Resource Collectionlocation not on record	46
Riverside, US	45
Nanjing, CN	45
MeiseBGlocation not on record	43
BDBClocation not on record	42
Wuhan, CN	40
Berlin, DE	40
Saint Louis, US	39
Pullman, US	38
Chiba, JP	37
Durham, US	36
UniKSlocation not on record	35
Mount Annan, AU	34
New Brunswick, US	34
Adelaide, AU	34
Bando, JP	33
San Diego, US	33
Beijing, CN	32
Emporia, US	32
Zhengzhou, CN	32
WTUlocation not on record	32
Western Carolina Universitylocation not on record	31
Canberra, AU	31
Christchurch, NZ	29
Santa Barbara, US	29
Guangzhou, CN	28
Ann Arbor, US	28
Tuscaloosa, US	27
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	26
Provincia di Livornolocation not on record	26
Toyama, JP	26
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	26
Fukushima Universitylocation not on record	25
Macomb, US	25
San Jose State University, Museum of Birds and Mammalslocation not on record	25
Olocation not on record	24
DMZ botanic gardenlocation not on record	24
New Haven, US	23
Burlington, US	23
Davis, US	23
Jackson, US	23
Hiratsuka City Museumlocation not on record	22
Lord Fairfax Community Collegelocation not on record	22
Chengdu, CN	22
Kunming, CN	22
Auckland, NZ	21
Fort Worth, US	21
Vitoria, ES	21
CJBGlocation not on record	21
Moscow, US	20
Tsukuba, JP	20
Pittsburg, US	20
Entomological Society of Latvialocation not on record	19
Nagatoro-machi, Chichibu-gun, JP	19
Brisbane, AU	19
València, ES	19
Tomioka, JP	19
MAlocation not on record	19
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	19
Canadian Department of Agriculturelocation not on record	19
Université Lavallocation not on record	18
Flagstaff, US	18
DBF-NHMDlocation not on record	18
Pretoria, ZA	18
Sanda, JP	18
Corvallis, US	18
BAYLUlocation not on record	17
Dekalb, US	17
Philadelphia, US	17
Albuquerque, US	17
San Luis Obispo, US	17
Oskarshamn, SE	17
Mississippi State, US	17
Staten Island, US	17
Denver, US	17
Québec, CA	16
Bern, CH	16
Kawasaki Shi Tama Ku, JP	15
NSMKlocation not on record	15
Asheville, US	15
Chengdu, CN	15
Institute of Applied Ecology, Academia Sinicalocation not on record	15
BClocation not on record	15
CICYTEXlocation not on record	15
Green Bay, US	14
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	14
Acadia Universitylocation not on record	14
ASUlocation not on record	14
Cape Town, ZA	14
DOI/NPS, Colonial National Historical Parklocation not on record	13
Knoxville, US	13
Norfolk, US	13
Spearfish, US	13
Tampa, US	13
KIWElocation not on record	13
Guilin, CN	13
Montréal, CA	13
Morgantown, US	13
Austin, US	13
Porto Alegre, BR	12
Universidad Católica de Santa Maríalocation not on record	12
Kensington, AU	12
Columbia, US	12
Hunan Hupingshan National Nature Reservelocation not on record	12
Urumqi, CN	11
US	11
Boise, US	11
EL PASO, US	11
Uppsala, SE	11
Chapel Hill, US	11
Otaru, JP	11
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	10
KMNlocation not on record	10
Northridge, US	10
Mexico City, MX	10
National Institute of Biological Resourceslocation not on record	10
CASlocation not on record	10
Sagamihara, JP	10
Rotorua, NZ	10
Fredericksburg, US	10
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	10
Davenport, US	10
Arcata, US	10
Mount Pleasant, US	10
DOI/NPS, Greenbelt Parklocation not on record	9
Durango, MX	9
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	9
Johnson City, US	9
Clemson, US	9
Xining, CN	9
Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record	9
Tempe, US	9
Urumqi, CN	9
JP	9
San Bernardino, US	8
KIRMlocation not on record	8
M-Lichenslocation not on record	8
Denton, US	8
Angwin, US	8
College of the Atlantic, Museumlocation not on record	8
Dover, US	8
Edmonton, CA	8
Hobart, AU	8
Tokushima, JP	8
Badajoz, ES	8
Lubbock, US	8
AUAlocation not on record	8
Severin-McDaniel Insect Collectionlocation not on record	8
China Agricultural Universitylocation not on record	8
Korea National Arboretumlocation not on record	8
GAlocation not on record	8
Wellington, NZ	8
QAUlocation not on record	8
Logan, US	7
GZFlocation not on record	7
Musee des Dinosaures d'Esperaza (Aude)location not on record	7
Ivano-Frankivsk, UA	7
University of Southern Mississippilocation not on record	7
Chicago, US	7
Armidale, AU	7
Whitewater, US	7
Frankfurt am Main	7
US	7
Long Beach, US	7
Adam Mickiewicz University in Poznańlocation not on record	7
Universidad del Pais Vasco (UPV/EHU)location not on record	7
Museo universitario di Chietilocation not on record	6
Parkville, AU	6
Kochi, JP	6
Conservatoire botanique national du Bassin parisienlocation not on record	6
UChlocation not on record	6
San Sebastián, ES	6
Nishihara, JP	6
Xinxiang, CN	6
McWane Science Centerlocation not on record	6
KOMlocation not on record	6
University of New Hampshirelocation not on record	6
Hudson, US	6
Caldwell, US	6
South Kensington, GB	6
Saint John, CA	6
Granada, ES	6
Stockholm, SE	6
Porrentruy, CH	6
Chadron, US	6
GZUlocation not on record	5
FFPRIlocation not on record	5
Keene State Universitylocation not on record	5
Durban, ZA	5
Córdoba, AR	5
Madrid, ES	5
J.F.Oberlin Universitylocation not on record	5
Provo, US	5
Wlocation not on record	5
Hangzhou, CN	5
Central China Normal Universitylocation not on record	5
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	5
Hamilton, US	5
Missoula, US	4
Waverly, US	4
Phoenix, US	4
Victoria, CA	4
Tilburg, NL	4
KNAMlocation not on record	4
Guiyang, CN	4
Changsha, CN	4
Bourges, FR	4
Turlock, US	4
Fairfax, US	4
Salamanca, ES	4
Tallinn, EE	4
Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record	4
Springfield, US	4
Tartu, EE	4
Glarus, CH	4
SDFlocation not on record	4
Irvine, US	4
KURAlocation not on record	4
Henry Brockhouse Collectionlocation not on record	4
Jefferson City, US	4
Jiangxi Universitylocation not on record	4
Fayetteville, US	4
Xian, CN	4
Ishikawa Museum of Natural Historylocation not on record	4
Tula State Universitylocation not on record	4
Anhui Normal Universitylocation not on record	4
Shanxi Institute of Biologylocation not on record	4
Iwate Prefectural Museumlocation not on record	4
Guiyang, CN	4
Shanxi Universitylocation not on record	4
ENTClocation not on record	4
Seoul, KR	3
Jishou Universitylocation not on record	3
Los Angeles, US	3
Miami, US	3
Lanzhou, CN	3
Portland, US	3
Vancouver, CA	3
Shanghai, CN	3
Beijing Normal Universitylocation not on record	3
Royal Botanical Gardenslocation not on record	3
Henderson, US	3
Kushiro City Museumlocation not on record	3
Guangzhou, CN	3
Richmond, US	3
Pocatello, US	3
University of Tennessee at Chattanoogalocation not on record	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3
Museum of the Rockieslocation not on record	3
Valparaiso, CL	3
James F. Matthews Center for Biodiversity Studieslocation not on record	3
Orem, US	3
Stephenville, US	3
Philadelphia, US	3
GB	3
BRNUlocation not on record	3
San Angelo, US	3
黔东南州民族医药研究所标本室location not on record	3
University of Johannesburglocation not on record	3
PrivatHerblocation not on record	3
Taipei, TW	3
Yunnan Universitylocation not on record	3
Osaka, JP	3
Alicante, ES	3
Tall Timbers Research Stationlocation not on record	3
Santa Cruz, US	3
US	3
Mlocation not on record	3
PUC-RSlocation not on record	3
Omachi Alpine Museumlocation not on record	3
Nishihara, JP	3
Little Rock, US	3
Chicago, US	3
Kew, GB	2
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	2
Córdoba, ES	2
Pamplona, ES	2
Appalachian State Universitylocation not on record	2
BGBMlocation not on record	2
Durango, US	2
VALElocation not on record	2
SJNAlocation not on record	2
Akita Prefectural Museumlocation not on record	2
Jiujiang Forestry Institutelocation not on record	2
CJBNlocation not on record	2
Castelar, AR	2
Ivano-Frankove, UA	2
University of Guelph, OAC Herbariumlocation not on record	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2
Conway, US	2
Meguro Parasitological Museumlocation not on record	2
Kirksville, US	2
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	2
Central China Agricultural Universitylocation not on record	2
Guangxi Agricultural Universitylocation not on record	2
Zhuzhou, CN	2
Shenyang Agricultural Universitylocation not on record	2
Zhejiang Universitylocation not on record	2
BGPAlocation not on record	2
Cheney, US	2
Conway, US	2
Uniwersytet Śląski w Katowicachlocation not on record	2
Podgorica, ME	2
Hangzhou Normal Collegelocation not on record	2
PRClocation not on record	2
Zhejiang Museum of Natural Historylocation not on record	2
nlocation not on record	2
Shenzhen, CN	2
Mohonk Preservelocation not on record	2
GMBAlocation not on record	2
Capital Normal Universitylocation not on record	2
Parthenon Tama History Museumlocation not on record	2
Phyletisches Museum Jenalocation not on record	2
Monastir, TN	2
Jiangxi College of Educationlocation not on record	2
WNNUlocation not on record	2
Mexico City, MX	2
Salvador, BR	2
Kiritappu Wetland National Trustlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Walla Walla, US	2
University of North Carolina at Pembrokelocation not on record	2
Chicago, US	1
DNSMlocation not on record	1
Universite de Montpellierlocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
Qarshi Botanical Gardenlocation not on record	1
Namur, BE	1
Bozeman, US	1
Frauenfeld, CH	1
Lake Charles, US	1
Museo della Bonifica di San Donà di Piavelocation not on record	1
贵州梵净山自然保护区标本馆location not on record	1
Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record	1
Russellville, US	1
Lausanne, CH	1
Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
Brookings, US	1
Sapporo, JP	1
McGill University, Herbariumlocation not on record	1
Universite de Montreal, L'Herbier Marie-Victorinlocation not on record	1
UPNlocation not on record	1
Institut de Biologia Evolutiva, (CSIC-UPF)location not on record	1
Chongqing, CN	1
Guiyang, CN	1
Beijing, CN	1
Guiyang, CN	1
Nagasaki University - Fisherieslocation not on record	1
Taiyuan Normal Universitylocation not on record	1
Wuhan, CN	1
Eastern Nevada Landscape Coalitionlocation not on record	1
Strecker Museum, Baylor Universitylocation not on record	1
Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record	1
La Paz, BO	1
DOI/NPS, Selma to Montgomery National Historic Traillocation not on record	1
Sendai, JP	1
Universität Erlangen-Nürnberglocation not on record	1
South China Normal Universitylocation not on record	1
Cambridge, US	1
Laboratorio de Ictiologialocation not on record	1
Sion, CH	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Bend, US	1
Minia, EG	1
Cincinnati, US	1
Zürich, CH	1
Weber State Universitylocation not on record	1
Herbario Universidad de Concepciónlocation not on record	1
Paris, FR	1
La Paz, MX	1
JBSlocation not on record	1
Decorah, US	1
West Virginia Wesleyan Collegelocation not on record	1
Torreón, MX	1
Hokkaido University Museumlocation not on record	1
Chapingo, MX	1
UFBAlocation not on record	1
UIBlocation not on record	1
Brussel, BE	1
San Jose, US	1
Tacoma, US	1
Catalina Island Conservancylocation not on record	1
Xiamen, CN	1
Dresden, DE	1
Madrid, ES	1
Helsinki, FI	1
Obihiro Centennial City Museumlocation not on record	1
San Diego Natural History Museum, Herbariumlocation not on record	1
IPE-CSIClocation not on record	1
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
Göteborg, SE	1
South African National Biodiversity Institute, Compton Herbariumlocation not on record	1
Royal Botanic Gardens, Kewlocation not on record	1
San Francisco, US	1
LINUlocation not on record	1
SIHUlocation not on record	1
Maryland Department of Natural Resourceslocation not on record	1
University of Alberta Museumslocation not on record	1
Lincoln, US	1
Texas Lutheran Universitylocation not on record	1
河南豫北黄河故道湿地鸟类国家级自然保护区location not on record	1
USFSlocation not on record	1
Banyoles, ES	1
Batemans Bay, AU	1
Jiangxi College of Traditional Chinese Medicinelocation not on record	1
Shanghai Chenshan Botanical Gardenlocation not on record	1
Nanchong, CN	1
Fulda, DE	1
Whitehorse, CA	1
Trondheim, NO	1
Santiago de Compostela, ES	1
University of British Columbia, Herbariumlocation not on record	1

443 institutions · 10 798 of 11 672 vouchered records shown · 690 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA429 detections

Where the DNA of Robinia pseudoacacia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found429

Studies independent surveys3

Countries13

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 429 detections have coordinates

Open the map13 countries0

Non coniferous evergreen forestsClose to a riparian area with eucalyptus, re…Cold N facing slope heavily forested with ma…meadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 16.5–16.5

Seasonal swing summer↔winter19.7 °C

Max temp (day)19.8 °C

Min temp (night)10.4 °C

Precipitation175 mm/mo

Air humidity56.4 %

Moisture balance53.3 mm/mo

Vapour deficit820 Pa

Wind speed1.40 m/s

Cloud cover41.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 414 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources17 archives

Size & morphology26

Life cycle & reproduction37

Diet & foraging2

Habitat & environment33

Physiology & chemistry29

Uses & economy16

Other traits14

Compound class profile5 classes

Documented compounds195 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

How it livedPBDB

Record type460 094 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions253 of 443 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type460 094 records