Ripogonum discolor

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Ripogonaceae/Ripogonum

At a glance

Occurrence records1 338

Data sources6

Biological traits33

DNA specimens2

eDNA detections1

Sources6 archives

Databases and archives Ripogonum discolor's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 338 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF1 338 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Ripogonum discolor, known as the prickly supplejack, is a common rainforest vine, found in eastern Australia. The original specimen was collected at the Clarence River. The species occurs in the states of Queensland and New South Wales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology13

Fruit length12.5 mm

Fruit width12.5 mm

Leaf length200 mm

Leaf length max200 mm

Leaf length min120 mm

Leaf width50 mm

Leaf width max50 mm

Leaf width min33 mm

Petiole length0.6 cm

Plant height4 m

Seed length6.25 mm

Seed mass85.81 mg

Seed width5.07 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timennnnnyyynnnn

Life formscrambling shrub

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberfacultative

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: climber_herbaceous · TRY: Lianas (wody climbers)

Leaf compoundnesssimple

Leaf shapeoblong

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ripogonum discolor has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences4

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKM895572.1 ↗553 bpAustralia

ACGT

AAGTGCTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGC …

Ripogonum discolor voucher 129308452 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa

plant barcode

08Occurrence & distribution

Record type1 338 records

Wild obs. + sensor1 115

Museum / vouchered204

Cultivated / captive4

Other15

Origin

Native59

Range

Area of Occupancy AOO2 936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 987≤1 km 51≤10 km 23>10 km 7

1 068 georeferenced · 47 without coordinates

Open the mapobservation + sensor1 115

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 22≤1 km 44≤10 km 75>10 km 17

158 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence204

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced · 1 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	59
Brisbane, AU	37
Armidale, AU	28
Canberra, AU	26
Museo Entomologico de Leonlocation not on record	18
John T. Waterhouse Herbariumlocation not on record	13
Smithfield, AU	8
Adelaide, AU	5
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Kew, GB	1
Wollongong, AU	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1

12 institutions · 201 of 204 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Ripogonum discolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.3 °C 19.3–19.3

Seasonal swing summer↔winter9.90 °C

Max temp (day)23.5 °C

Min temp (night)15.6 °C

Precipitation128 mm/mo

Air humidity61.9 %

Moisture balance15.0 mm/mo

Vapour deficit865 Pa

Wind speed1.40 m/s

Cloud cover24.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ripogonum discolor

At a glance

Sources6 archives

Size & morphology13

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

At a glance

Record type1 338 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 338 records