Ripogonum brevifolium

Conran & Clifford · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Ripogonaceae/Ripogonum

At a glance

Occurrence records511

Data sources6

Biological traits32

DNA specimens3

eDNA detections2

Sources6 archives

Databases and archives Ripogonum brevifolium's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility511 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Occurrence & distributionGBIF511 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Ripogonum brevifolium, commonly known as small–leaved supplejack, is a vine, or sometimes a shrub, native to Australia. The species occurs in the states of Queensland and New South Wales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length11.5 mm

Fruit width11.5 mm

Leaf length65 mm

Leaf length max80 mm

Leaf length min30 mm

Leaf mass per area88.45 g/m2

Leaf size838 mm²

⚠ sources differ — TRY: 838 mm² · AusTraits: 775 mm²

Leaf width25 mm

Leaf width max30 mm

Leaf width min15 mm

Petiole length0.5 cm

Plant height10 m

Seed length8 mm

Seed width5 mm

Life cycle & reproduction6

Dehiscenceindehiscent

Flowering timennnnnnnnyyyy

Life formscrambling shrub

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberfacultative

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: climber shrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry1

Specific leaf area (SLA)11.32 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ripogonum brevifolium has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences5

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKU564863.1 ↗573 bpAustralia

ACGT

AAGTGCTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGC …

Ripogonum brevifolium ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type511 records

Wild obs. + sensor308

Museum / vouchered116

Other87

Origin

Native11

Introduced1

Range

Area of Occupancy AOO1 428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 232≤1 km 13≤10 km 4>10 km 4

253 georeferenced · 55 without coordinates

Open the mapobservation + sensor308

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 34≤1 km 6≤10 km 37>10 km 22

99 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	62
Museo Entomologico de Leonlocation not on record	18
Mount Annan, AU	12
Armidale, AU	10
Canberra, AU	4
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Adelaide, AU	2
Smithfield, AU	1
Palmerston, AU	1

10 institutions · 114 of 116 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Ripogonum brevifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.7 °C 17.4–20.1

Seasonal swing summer↔winter9.80 °C

Max temp (day)22.4 °C 22.3–22.5

Min temp (night)15.4 °C 12.9–17.9

Precipitation107 mm/mo 83.2–131

Air humidity59.4 % 59.0–59.8

Vapour deficit889 Pa 828–949

Cloud cover24.6 % 24.1–25.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)