Ripogonum album

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Ripogonaceae/Ripogonum

At a glance

Occurrence records1 987

Data sources6

Biological traits38

DNA specimens14

eDNA detections8

Sources6 archives

Databases and archives Ripogonum album's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 987 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~8.87 Gbp↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources38 traits

Occurrence & distributionGBIF1 987 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI14 specimens

Genome at a glanceGoaT8.9 Gbp

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology16

Fruit length13 mm

Fruit width10.5 mm

Leaf length125 mm

Leaf length max170 mm

Leaf length min80 mm

Leaf mass122 mg

Leaf mass per area43.27 g/m2

Leaf size3 032 mm²

Leaf width42.5 mm

Leaf width max55 mm

Leaf width min30 mm

Petiole length0.95 cm

Plant height20 m

Plant height max6 m

Seed length7.5 mm

Seed width6.5 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyyyyyynnyyyy

Life formclimber

Life spanperennial

Pollination syndromebee

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: climber_herbaceous · TRY: climber

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ripogonum album has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes5

GenBank sequences10

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKF496404.1 ↗552 bpAustralia · 2013

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Rhipogonum album isolate CERF127-10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6★rbcLa★ITStrnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceGoaT

The complete instruction manual Ripogonum album carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size8 865 370 408 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Ripogonum album8.87 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type1 987 records

Wild obs. + sensor1 461

Museum / vouchered379

Cultivated / captive2

Other145

Origin

Native43

Introduced2

Range

Area of Occupancy AOO4 788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 208≤1 km 104≤10 km 70>10 km 6

1 388 georeferenced · 73 without coordinates

Open the mapobservation + sensor1 461

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 44≤1 km 66≤10 km 141>10 km 36

287 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence379

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	100
Museo Entomologico de Leonlocation not on record	78
Brisbane, AU	51
Mount Annan, AU	44
Canberra, AU	34
John T. Waterhouse Herbariumlocation not on record	13
Batemans Bay, AU	7
Palmerston, AU	6
Armidale, AU	5
Parkville, AU	4
Kew, GB	3
James Cook Townsvillelocation not on record	3
La Trobe Universitylocation not on record	3
Adelaide, AU	3
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Copenhagen, DK	2
Hobart, AU	1
Clocation not on record	1
Zürich, CH	1
Wollongong, AU	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Paris, FR	1
South Kensington, GB	1
University of the Sunshine Coastlocation not on record	1
Australian Tropical Herbariumlocation not on record	1

25 institutions · 367 of 379 vouchered records shown · 11 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Ripogonum album was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 16.6–21.6

Seasonal swing summer↔winter9.30 °C

Max temp (day)24.5 °C 21.1–27.3

Min temp (night)15.3 °C 12.3–16.9

Precipitation63.3 mm/mo 22.0–221

Air humidity59.5 % 48.0–66.3

Moisture balance-49.6 mm/mo -121–91.2

Vapour deficit868 Pa 717–1,424

Wind speed3.00 m/s 1.70–3.80

Cloud cover26.9 % 20.1–37.7

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ripogonum album

At a glance

Sources6 archives

Size & morphology16

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

At a glance

Genome sizehow big the whole instruction manual is

Record type1 987 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 987 records