Ripartitella brasiliensis

(Speg.) Singer · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Agaricaceae/Ripartitella

At a glance

Occurrence records108

Data sources8

Biological traits0

DNA specimens5

eDNA detections10

Sources8 archives

Databases and archives Ripartitella brasiliensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility108 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF108 records

Environmental DNA4 datasets · 3 countries10 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Ripartitella brasiliensis is a species of fungus in the family Agaricaceae. It was originally described as new to science by Carlos Luigi Spegazzini in 1889. The fungus is found in the southwestern United States and Mexico, Central and South America, Africa, and the Bonin Islands of the western Pacific Ocean. It fruits in clusters on the decaying wood of hardwood trees, especially oak.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ripartitella brasiliensis has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences10

eDNA detections10

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOQ916918.1 ↗456 bpBrazil · 2022

ACGT

GTGCACATCTGTTACTTTTATACTCTTCCACCTGTGCACCATTTGTAGACCTTGGATTTTTCTCGAGGATTAAACTCGGATTGGAGATTT …

Ripartitella brasiliensis voucher DAZ108 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1028SEF1-alpha

fungal barcodemarker

08Occurrence & distribution

Record type108 records

Wild obs. + sensor61

Museum / vouchered47

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 14≤1 km 11≤10 km 6>10 km 13

44 georeferenced · 17 without coordinates

Open the mapobservation + sensor61

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1≤10 km 1

4 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	7
Chicago, US	6
IPA/SPlocation not on record	5
EcoFoG FunGuy collectionlocation not on record	5
Universidade Federale do Rio Grande do Sullocation not on record	5
Colorado State Universitylocation not on record	5
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	3
FLASlocation not on record	3
Zapopan, MX	2
Kew, GB	1
Universidade Federal de Santa Catarinalocation not on record	1
UFSClocation not on record	1
Lake Charles, US	1
Baton Rouge, US	1
Herbier de Lille (Fr)-LIPlocation not on record	1

15 institutions · 47 of 47 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Ripartitella brasiliensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys4

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 17.0–22.6

Seasonal swing summer↔winter3.20 °C

Max temp (day)24.6 °C 21.2–25.1

Min temp (night)13.8 °C 9.60–20.2

Precipitation168 mm/mo 23.0–275

Air humidity66.9 % 51.0–69.9

Moisture balance-2.50 mm/mo -62.7–170

Vapour deficit830 Pa 666–949

Wind speed1.40 m/s 1.30–2.90

Cloud cover26.0 % 24.7–66.7

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)