Rinzia orientalis

Rye · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Rinzia

At a glance

Occurrence records608

Data sources6

Biological traits35

DNA specimens0

eDNA detections2

Sources6 archives

Databases and archives Rinzia orientalis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility608 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF608 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Rinzia orientalis, commonly known as desert heath-myrtle, is a species of flowering plant in the family Myrtaceae and is endemic to south-eastern Australia. It is a shrub with elliptic to narrowly oblong leaves and white or pale pink flowers usually with ten stamens.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology9

Leaf length3 mm

Leaf length max3 mm

Leaf length min1 mm

Leaf mass per area350 g/m2

Leaf width0.5 mm

Leaf width max0.5 mm

Plant height0.75 m

Plant height max1.3 m

Plant height min0.3 m

Life cycle & reproduction9

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal+self

Flowering timeyynnnnnnyyyy

Life formsubshrub or shrub

Life spanperennial

Pollination syndromebird+insect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear narrowly_obovate

Mycorrhiza typeectomycorrhizal

Woodinesswoody

Physiology & chemistry5

Leaf n9.4 mg/g

Leaf p0.394 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)2.9 mm²/mg

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rinzia orientalis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

matKAF489362.2 ↗2 459 bpAustralia

ACGT

GTAGAGTACTCGGCTTTTAAGTGCGGCTAGCATCTTTTACACATTTATATGAAGTAACGGATTCGTTCATACCTTCGGTAGAGTTTGTAA …

Rinzia orientalis isolate s15 trnK gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type608 records

Wild obs. + sensor608

Range

Area of Occupancy AOO1 124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 319≤1 km 60≤10 km 22>10 km 31

432 georeferenced · 176 without coordinates

Open the mapobservation + sensor608

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA2 detections

Where the DNA of Rinzia orientalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)