Rinorea thomasii

Achound. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Violaceae/Rinorea

At a glance

Occurrence records15

Data sources8

Biological traits4

DNA specimens7

eDNA detections3

Sources8 archives

Databases and archives Rinorea thomasii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Rinorea thomasii is a species of plant in the Violaceae family. It is endemic to Cameroon. Its natural habitat is subtropical or tropical moist lowland forests. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climatewet tropical

Growth formshrub

Woodinesswoody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rinorea thomasii has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKC628203.1 ↗704 bpCameroon · 2008

ACGT

CAAGTGTTGGATTCAAGGCTGGGGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAG …

Rinorea thomasii voucher PM5401 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type15 records

Wild obs. + sensor1

Museum / vouchered14

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universite Libre de Bruxelleslocation not on record	3
Kew, GB	2

2 institutions · 5 of 14 vouchered records shown · 9 without an institution code

09Environmental DNA3 detections

Where the DNA of Rinorea thomasii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 24.2–24.6

Seasonal swing summer↔winter2.80 °C

Max temp (day)27.7 °C 27.7–28.5

Min temp (night)21.8 °C

Precipitation405 mm/mo 206–405

Air humidity74.7 % 72.9–74.7

Moisture balance296 mm/mo 94.0–296

Vapour deficit763 Pa 763–840

Wind speed0.9 m/s 0.9–1.00

Cloud cover33.4 % 24.8–33.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)