Rigidoporus laetus — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Meripilaceae/Rigidoporus

At a glance

Occurrence records282

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Rigidoporus laetus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility282 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF282 records

DNA & barcodingNCBIsequences

01Narrative

Rigidoporus laetus is a species of polypore fungus in the family Meripilaceae. It was originally described in 1883 as Polyporus laetus by Mordecai Cubitt Cooke. Peter Buchanan and Leif Ryvarden transferred it to Rigidoporus in 1988. Found in south Australia, the fungus is a plant pathogen that causes white rot in Eucalyptus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rigidoporus laetus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN007028.1 ↗922 bpNew Zealand · 2005

ACGT

AGCTGCCTACCTGAAAAAGAAAAGGATGTGCCCATGAGTCCTCCCGTGCCCTCCGCGCGGGGCCACTGTGCAAAGTCCGTCCATGTCAAG …

Rigidoporus laetus isolate NZFS 2824 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type282 records

Wild obs. + sensor206

Museum / vouchered76

Range

Area of Occupancy AOO572 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 44≤1 km 42≤10 km 8>10 km 3

97 georeferenced · 109 without coordinates

Open the mapobservation + sensor206

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 6≤1 km 22≤10 km 41>10 km 3

72 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	59
Canberra, AU	8
Auckland, NZ	4
Hobart, AU	2
Olocation not on record	1
Brisbane, AU	1
DPIlocation not on record	1

7 institutions · 76 of 76 vouchered records shown