Ricinodendron heudelotii

(Baill.) Heckel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Ricinodendron

At a glance

Occurrence records769

Data sources11

Biological traits34

DNA specimens9

eDNA detections5

Sources11 archives

Databases and archives Ricinodendron heudelotii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility769 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources34 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF769 records

Environmental DNA1 datasets · 3 countries5 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Ricinodendron est un genre de plantes à fleurs de la famille des Euphorbiaceae décrit en 1864 par Müll.Arg.. À l'heure actuelle, il ne comprend qu'une seule espèce, qui est un arbre originaire d'Afrique tropicale, dont la distribution géographique va du Sénégal et du Liberia au Soudan, en Tanzanie, au sud au Mozambique et en Angola. Schinziophyton rautanenii (en), appelé Mongongo, avait initialement été considéré comme une espèce de ce genre, mais a été plus tard décrit dans le genre Schinziophyton plus approprié.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Plant height30 m

⚠ sources differ — GIFT: 30 m · TRY: 12.13 m

Plant height max45.72 m

Seed mass1 590 mg

Seed mass max1 590 mg

Seed mass min1 590 mg

Seed volume1 600 mm³

Seed volume max1 600 mm³

Seed volume min1 600 mm³

Life cycle & reproduction7

Deciduousnessdeciduous

Flowering endMar

Flowering startMar

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Mycorrhiza type0.000000637

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio12.22 g/g

Leaf c436 mg/g

Leaf dry-matter content (LDMC)260 mg/g

Leaf n36.04 mg/g

Leaf p3.54 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density219 mg/cm³

Other traits2

Fruiting endNov

Fruiting startNov

03Chemical composition5 compounds

Compounds documented for Ricinodendron heudelotii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Lupane triterpenoids1

Cinnamic acids and derivatives1

Podocarpane diterpenoids1

Abeoabietane diterpenoids $ Icetexane diterpenoids $ Podocarpane diterpenoids1

Simple phenolic acids1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
1,2-Dihydroheudelotinol	present	LOTUS
3-Methylorsellinic acid	present	LOTUS
Heudelotinone	present	LOTUS
Lupeol	present	LOTUS
trans-Ferulic acid	present	LOTUS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ricinodendron heudelotii has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences2

eDNA detections5

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMT040452.1 ↗705 bp

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCACAGCAGACGACCCGCGAACGTGTTATGTTACA …

Ricinodendron heudelotii voucher Chase 1269 (K) 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S subunit ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Ricinodendron heudelotii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-fedorov · CCDB · Cave1957

CCDB · book-fedorov — Mangenot S., !\langenot G. 1957

CCDB · Cave1957 — Mangenot & Mangenot

08Occurrence & distribution

Record type769 records

Wild obs. + sensor418

Museum / vouchered349

Other2

Range

Area of Occupancy AOO1 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 3≤1 km 3>10 km 1

7 georeferenced · 411 without coordinates

Open the mapobservation + sensor418

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 3

4 georeferenced · 345 without coordinates

Open the institutions mapphysical evidence349

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 50 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	32
MeiseBGlocation not on record	30
LBVlocation not on record	20
Yaoundé, CM	18
Paris, FR	16
LSF/FSA/UAClocation not on record	16
WAGlocation not on record	15
BRLUlocation not on record	12
Kew, GB	11
Herbier National du Gabonlocation not on record	9
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	9
Plocation not on record	5
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	4
Pretoria, ZA	4
Bronx, US	3
TAFORI-LSRClocation not on record	3
EAlocation not on record	3
MAlocation not on record	3
Berlin, DE	3
Davis, US	3
Université du Lomélocation not on record	2
University of Stellenboschlocation not on record	2
EFGlocation not on record	2
Clocation not on record	2
HNBlocation not on record	2
Dresden, DE	2
University of Santo Tomas Museumlocation not on record	2
Stockholm, SE	2
Leiden University Medical Centerlocation not on record	2
National Botanical Gardens of Belgiumlocation not on record	2
Botanic Gardenlocation not on record	2
ex-Centro Nacional de Investigação Cientifica (CNIC)location not on record	1
Botanical Garden "Anastasie Fatu" of Iasilocation not on record	1
South Kensington, GB	1
CJBGlocation not on record	1
CNF-UFHBlocation not on record	1
Claremont, US	1
IPHAMETRAlocation not on record	1
Brussels, BE	1
Budapest, HU	1
LGlocation not on record	1
Calabar, NG	1
University of Oxfordlocation not on record	1
Forestry Research Institute of Nigerialocation not on record	1
Daubeny Herbarium, Oxfordlocation not on record	1
Fort Worth, US	1
LISClocation not on record	1
Universite Libre de Bruxelles, Herbariumlocation not on record	1
Goucher Collegelocation not on record	1
Mlocation not on record	1

50 institutions · 260 of 349 vouchered records shown · 89 without an institution code

09Environmental DNA5 detections

Where the DNA of Ricinodendron heudelotii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 23.6–26.2

Seasonal swing summer↔winter1.90 °C

Max temp (day)28.6 °C 28.1–31.2

Min temp (night)20.7 °C 20.3–22.4

Precipitation81.8 mm/mo 54.1–166

Air humidity67.9 % 65.9–71.4

Moisture balance-46.8 mm/mo -70.0–38.7

Vapour deficit956 Pa 833–1,160

Wind speed1.20 m/s 1.00–2.20

Cloud cover38.9 % 18.4–54.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)