Riccia canaliculata

Hoffm. · species

image placeholder — illustration coming later

Plantae/Marchantiophyta/Marchantiopsida/Marchantiales/Ricciaceae/Riccia

At a glance

Occurrence records942

Data sources9

Biological traits1

DNA specimens3

eDNA detections1

Sources9 archives

Databases and archives Riccia canaliculata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility942 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF942 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Riccia canaliculata is a species of liverwort belonging to the family Ricciaceae. It is native to Europe and Northern America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formnonvascular

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Riccia canaliculata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLLC924744.1 ↗1 428 bpJapan · 2021

ACGT

ATGTCACCACAAACGGAGACCAAAGCAGGTGCTGGATTCAAAGCTGGTGTTAAAGATTATCGATTAACTTATTACACTCCAGATTATGAG …

Riccia canaliculata TNS:MH:256308 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, complete cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Riccia canaliculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 81×CCDB · book-ipcn66

CCDB · book-ipcn66 — Poelt 1966

08Occurrence & distribution

Record type942 records

Wild obs. + sensor502

Museum / vouchered436

Cultivated / captive3

Fossil1

Origin

Native26

Range

Area of Occupancy AOO2 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 136≤1 km 73≤10 km 217>10 km 11

437 georeferenced · 65 without coordinates

Open the mapobservation + sensor502

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 23≤1 km 110≤10 km 77>10 km 29

239 georeferenced · 197 without coordinates

Open the institutions mapphysical evidence436

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussel, BE	77
Uppsala, SE	69
LDlocation not on record	56
Clocation not on record	23
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	18
SLU Artdatabankenlocation not on record	18
Olocation not on record	17
Trondheim, NO	17
Tilburg, NL	15
New Haven, US	10
Institute of the Industrial Ecology Problems of the North of Kola Science Center of the Russian Academy of Sciences.location not on record	9
Polar-Alpine Botanical Garden-Institutelocation not on record	8
Madison, US	5
Oskarshamn, SE	5
Knoxville, US	5
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	5
Bronx, US	4
Frankfurt am Main	4
South Kensington, GB	3
MeiseBGlocation not on record	3
Edinburgh, GB	3
Saint Louis, US	2
GJOlocation not on record	2
SZUlocation not on record	2
Moscow State Universitylocation not on record	2
McWane Science Centerlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Stockholm, SE	2
Bourges, FR	2
Vancouver, CA	2
Auckland, NZ	1
University of Stellenboschlocation not on record	1
Zürich, CH	1
MAlocation not on record	1
Finnish Museum of Natural History, Botanical Museumlocation not on record	1
Oulu, FI	1
Uniwersytet Wrocławskilocation not on record	1
Helsinki, FI	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Senckenberg Institute for Plant Form and Function at Friedrich Schiller University Jenalocation not on record	1
PHlocation not on record	1

41 institutions · 403 of 436 vouchered records shown · 33 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Riccia canaliculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter22.4 °C

Max temp (day)18.8 °C

Min temp (night)12.2 °C

Precipitation86.4 mm/mo

Air humidity62.0 %

Moisture balance4.30 mm/mo

Vapour deficit657 Pa

Wind speed2.10 m/s

Cloud cover47.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)