Ribes watsonianum

Koehne · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Grossulariaceae/Ribes

At a glance

Occurrence records141

Data sources5

Biological traits10

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Ribes watsonianum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility141 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF141 records

DNA & barcodingNCBIsequences

01Narrative

Ribes watsonianum is a North American species of currant known by the common names spring gooseberry and wild gooseberry, found in the US states of Washington and Oregon.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass1.77 mg

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ribes watsonianum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF426360.1 ↗541 bp

ACGT

CCTTTCGAGTCGGTGTCGTGACCGTGCGCTCCCGGCAAACACAACGAACCCCGGCGTNAATTGCGCCAAGGAAATATAAAAGAAGGATCA …

Ribes watsonianum isolate dna43 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 1, complete sequence and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type141 records

Wild obs. + sensor45

Museum / vouchered63

Other33

Origin

Native33

Range

Area of Occupancy AOO320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 22≤1 km 2≤10 km 1>10 km 3

28 georeferenced · 17 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 8≤1 km 10≤10 km 18>10 km 3

39 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence63

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pullman, US	22
WTUlocation not on record	19
Corvallis, US	8
DOI/NPS, Mount Rainier National Parklocation not on record	4
Moscow, US	3
Boise, US	1
Tacoma, US	1
Portland, US	1
Riverside, US	1
University of Stellenboschlocation not on record	1
Portland, US	1
St. Paul, US	1

12 institutions · 63 of 63 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)