Ribes viburnifolium

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Grossulariaceae/Ribes

At a glance

Occurrence records628

Data sources11

Biological traits92

DNA specimens5

eDNA detections3

Sources11 archives

Databases and archives Ribes viburnifolium's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility628 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources92 traits

Occurrence & distributionGBIF628 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Ribes viburnifolium, is an uncommon North American species in the gooseberry family. It is known by the common names Catalina currant, Santa Catalina Island currant, island gooseberryCalflora taxon report, University of California, Ribes viburnifolium A. Gray, Catalina currant, Santa Catalina Island currant, island gooseberry and evergreen currant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height0.91 m

Seed mass5.44 mg

⚠ sources differ — TRY: 5.44 mg · GIFT: 3.48 mg

Seed mass max5.44 mg

Seed mass min5.44 mg

Life cycle & reproduction23

Bloom periodMid Spring

Coppice potentialNo

Flower colourpurple

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDARapid

Life formshrub

Life spanperennial

Lifespan categoryShort

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsYes

Propagated by seedNo

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityYes

Seed spread rateSlow

Seedling vigorMedium

Vegetative spread rateModerate

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring, Summer, Fall

Adapted to coarse textured soilsYes

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerDense

Foliage porosity winterDense

Foliage textureCoarse

Fruit colourred

Growth formshrub

Growth form USDAThicket Forming

Hedge toleranceNone

Known allelopathNo

Leaf retentionYes

Low growing grassNo

Root depth min12 in

Shape and orientationProstrate

Small grainNo

Woodinesswoody

Physiology & chemistry19

Anaerobic toleranceNone

C:N ratioHigh

Caco3 toleranceLow

Cold stratification requiredNo

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceHigh

Frost free days min190 days

Moisture useLow

Nitrogen fixation levelNone

Precipitation max40 in

Precipitation min18 in

Protein potentialMedium

Salinity toleranceNone

Shade toleranceLow

Soil pH max7.5 pH

Soil pH min5 pH

Temperature min-3 °F

Uses & economy14

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityContracting Only

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalMedium

Palatable humanYes

Post productNo

Pulpwood productNo

Seeds per pound300 000 per lb

ToxicityNone

Veneer productNo

Other traits7

Fall conspicuousYes

Fruit seed abundanceHigh

Fruit seed conspicuousYes

Fruit seed persistenceNo

Height at 20yr0.914 m

Planting density max2 700 per acre

Planting density min1 200 per acre

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ribes viburnifolium has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF426371.1 ↗689 bp

ACGT

TTTCAGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCCTAGCAGAACGACCCGTGAACACGTAGTTATCAACGGGGGTCGGGGC …

Ribes viburnifolium isolate dna54 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 1, complete sequence and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ribes viburnifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · eflora · CCDB · Cave1956supp

CCDB · eflora

CCDB · Cave1956supp — Hamel 1953

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type628 records

Wild obs. + sensor292

Museum / vouchered298

Other38

Origin

Native59

Range

Area of Occupancy AOO844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 155≤1 km 13≤10 km 2>10 km 2

172 georeferenced · 120 without coordinates

Open the mapobservation + sensor292

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 103≤1 km 36≤10 km 25>10 km 9

173 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence298

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	89
Claremont, US	51
Santa Barbara, US	24
Calabar, NG	17
Riverside, US	16
San Francisco, US	13
Ensenada, MX	8
Catalina Island Conservancylocation not on record	7
Saint Louis, US	6
CASlocation not on record	5
Los Angeles, US	5
Mexico City, MX	4
Mexico City, MX	4
Pomona Collegelocation not on record	3
Severin-McDaniel Insect Collectionlocation not on record	2
ASUlocation not on record	2
Bronx, US	2
La Paz, MX	2
Logan, US	2
Davis, US	2
Uniwersytet Jagiellońskilocation not on record	2
Chicago, US	1
US	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Mexico City, MX	1
Long Beach, US	1
Chicago, US	1
San Bernardino, US	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Universidad Católica de Manizaleslocation not on record	1
Arizona State University Biocollectionslocation not on record	1
Tampa, US	1
Austin, US	1
Bloomington, US	1
Cambridge, US	1
Auckland, NZ	1
San Luis Obispo, US	1

38 institutions · 283 of 298 vouchered records shown · 15 without an institution code

09Environmental DNA3 detections

Where the DNA of Ribes viburnifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Heteromeles, Rhus, Polypodium, Canyon; steep…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 14.4–14.4

Seasonal swing summer↔winter7.20 °C

Max temp (day)16.2 °C

Min temp (night)12.8 °C

Precipitation21.9 mm/mo

Air humidity62.2 %

Moisture balance-99.7 mm/mo

Vapour deficit620 Pa

Wind speed3.30 m/s

Cloud cover31.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)