Ribes nevadense

Kellogg · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Grossulariaceae/Ribes

At a glance

Occurrence records2 711

Data sources9

Biological traits93

DNA specimens2

eDNA detections1

Sources9 archives

Databases and archives Ribes nevadense's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 711 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources93 traits

Occurrence & distributionGBIF2 711 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Ribes nevadense (sometimes spelled R. nevadaenseFlora of North America) is a species of currant known by the common names Sierra currant and mountain pink currant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height1.8 m

Seed mass1.25 mg

Seed mass max1.77 mg

Seed mass min1.16 mg

Life cycle & reproduction24

Bloom periodLate Spring

Coppice potentialYes

Dispersal typeanimal

Flower colourred

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDAModerate

Life formshrub

Life spanperennial

Lifespan categoryLong

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsYes

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityYes

Seed spread rateSlow

Seedling vigorMedium

Vegetative spread rateSlow

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerDense

Foliage porosity winterModerate

Foliage textureMedium

Fruit colourblue

Growth formshrub

Growth form USDAMultiple Stem

Hedge toleranceLow

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min14 in

Shape and orientationSemi-Erect

Small grainNo

Woodinesswoody

Physiology & chemistry19

Anaerobic toleranceMedium

C:N ratioHigh

Caco3 toleranceMedium

Cold stratification requiredYes

Drought toleranceLow

Fertility requirementLow

Fire resistantNo

Fire toleranceMedium

Frost free days min160 days

Moisture useHigh

Nitrogen fixation levelNone

Precipitation max24 in

Precipitation min12 in

Protein potentialLow

Salinity toleranceNone

Shade toleranceMedium

Soil pH max7.5 pH

Soil pH min6 pH

Temperature min-28 °F

Uses & economy14

Berry nut seed productYes

Christmas tree productNo

Commercial availabilityContracting Only

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalHigh

Palatable humanYes

Post productNo

Pulpwood productNo

Seeds per pound391 000 per lb

ToxicityNone

Veneer productNo

Other traits7

Fall conspicuousYes

Fruit seed abundanceMedium

Fruit seed conspicuousYes

Fruit seed persistenceYes

Height at 20yr1.83 m

Planting density max1 700 per acre

Planting density min700 per acre

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ribes nevadense has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF426339.1 ↗704 bp

ACGT

CGTAACAAGGTTTCCGTAGGTAGAACCTGCGGAAGGATCATTGTCGATACCTGCCTAGCAGAACGACCCGCGAACACGTACTTATCAACG …

Ribes nevadense isolate dna22 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 1, complete sequence and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type2 711 records

Wild obs. + sensor1 521

Museum / vouchered833

Other357

Origin

Native153

Range

Area of Occupancy AOO4 252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 913≤1 km 137≤10 km 78>10 km 30

1 158 georeferenced · 363 without coordinates

Open the mapobservation + sensor1 521

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 26≤1 km 260≤10 km 196>10 km 1

483 georeferenced · 350 without coordinates

Open the institutions mapphysical evidence833

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	171
Riverside, US	108
Santa Barbara, US	55
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	51
Davis, US	50
San Diego, US	46
Arcata, US	39
Angwin, US	28
WTUlocation not on record	19
US	16
Los Angeles, US	15
San Luis Obispo, US	14
CASlocation not on record	10
Fredericton Stock Culture Collectionlocation not on record	8
Canadian Department of Agriculturelocation not on record	7
Severin-McDaniel Insect Collectionlocation not on record	6
Bronx, US	6
San Jose, US	6
Northridge, US	5
Long Beach, US	4
ASUlocation not on record	3
STNFlocation not on record	3
San Bernardino, US	3
Truckee, US	2
Phoenix, US	2
Logan, US	2
Irvine, US	2
Wuzhou, CN	2
St. Paul, US	2
Boise, US	1
Wellington, NZ	1
University of Stellenboschlocation not on record	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Chongqing Museumlocation not on record	1
Henderson, US	1
Flagstaff, US	1
EL PASO, US	1
Olocation not on record	1

38 institutions · 694 of 833 vouchered records shown · 138 without an institution code

09Environmental DNA1 detections

Where the DNA of Ribes nevadense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 12.6–12.6

Seasonal swing summer↔winter14.1 °C

Max temp (day)19.8 °C

Min temp (night)6.40 °C

Precipitation37.7 mm/mo

Air humidity56.4 %

Moisture balance-85.7 mm/mo

Vapour deficit641 Pa

Wind speed1.50 m/s

Cloud cover29.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ribes nevadense

At a glance

Sources9 archives

Size & morphology4

Life cycle & reproduction24

Diet & foraging1

Habitat & environment24

Physiology & chemistry19

Uses & economy14

Other traits7

At a glance

Record type2 711 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions26 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 711 records