Ribes missouriense

Nutt. ex Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Grossulariaceae/Ribes

At a glance

Occurrence records2 650

Data sources6

Biological traits13

DNA specimens8

eDNA detections4

Sources6 archives

Databases and archives Ribes missouriense's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 650 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF2 650 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI8 specimens

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass2.77 mg

Seed mass max2.8 mg

Seed mass min2.78 mg

Life cycle & reproduction3

Dispersal typeanimal

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ribes missouriense has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG237397.1 ↗322 bpUSA · 1952

ACGT

GTTGCGCCTGAAGCCATTCGGCCGAAGGCACGTCTGCCTGGGCGTCACGTACCCAATCGCCCCCCAAANCCTCCCACATCTCTAGCGATT …

Ribes missouriense voucher CCDB-23390-E09 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★rbcLa★ITS4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type2 650 records

Wild obs. + sensor2 167

Museum / vouchered459

Cultivated / captive1

Other23

Origin

Native17

Introduced1

Range

Area of Occupancy AOO7 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 348≤1 km 240≤10 km 72>10 km 172

1 832 georeferenced · 335 without coordinates

Open the mapobservation + sensor2 167

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 46≤1 km 37≤10 km 137>10 km 35

255 georeferenced · 204 without coordinates

Open the institutions mapphysical evidence459

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	253
St. Paul, US	192
Tempe, US	3
Mlocation not on record	2
Chicago, US	2
Meguro Parasitological Museumlocation not on record	1
Chapel Hill, US	1
Beijing, CN	1
Millersville, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
ASUlocation not on record	1
Wlocation not on record	1

12 institutions · 459 of 459 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Ribes missouriense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

Floodplain forestwoodsSprawling shrub to 2m. High in rich deciduou…transition between oak-hickory and others

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ribes missouriense

At a glance

Sources6 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Record type2 650 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 650 records