Ribes magellanicum

Poir. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Grossulariaceae/Ribes

At a glance

Occurrence records758

Data sources9

Biological traits15

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Ribes magellanicum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility758 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF758 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · TreeOfSex2n = 32

01Narrative

Ribes magellanicum is a South American species of shrubs in the currant family, found in Patagonia (southern Chile and Argentina).Marticorena, C. & M. Quezada. 1985. Catálogo de la Flora Vascular de Chile. Gayana, Botánica 42: 1–157.Zuloaga, F. O., O. Morrone, M. J. Belgrano, C. Marticorena & E. Marchesi. (eds.) 2008. Catálogo de las plantas vasculares del Cono Sur. Monographs in Systematic Botany from the Missouri Botanical Garden 107(1–3): i–xcvi, 1–3348. Two subspecies are accepted: Ribes magellanicum subsp. magellanicum Ribes magellanicum subsp. parviflorum Sparre

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height1.5 m

Seed mass2.4 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Wood density570 mg/cm³

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ribes magellanicum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ430054.1 ↗737 bpChile

ACGT

GAACAAGGTTTCTGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCCTAGCAGAAACGACCCGTGAACACGTAGTTATCAACGGG …

Ribes magellanicum voucher EIF 11836 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB · TreeOfSex

The complete instruction manual Ribes magellanicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 162×CCDB · ipcn-api-dl · TreeOfSex · plant

CCDB · ipcn-api-dl — Dollenz, O. 1978. Números cromosómicos de espermatófitas de los géneros Berberis, Ribes y Festuca. Anales Inst. Patagonia, Ser. Ci. Nat. 9: 141–144.

TreeOfSex · plant — Goldblatt1979 ↗

n 81×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Moore, D. M. 1981. Cromosome numbers of Fuegian angiosperms. Bol. Soc. Brot. 53: 995–1012.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type758 records

Wild obs. + sensor635

Museum / vouchered96

Cultivated / captive5

Other22

Origin

Native1

Introduced1

Range

Area of Occupancy AOO1 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 341≤1 km 85≤10 km 65>10 km 13

504 georeferenced · 131 without coordinates

Open the mapobservation + sensor635

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 3

6 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence96

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 4 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edinburgh, GB	16
Saint Louis, US	14
MAlocation not on record	12
San Isidro, AR	10
Kew, GB	6
UChlocation not on record	4
University of Stellenboschlocation not on record	4
ASUlocation not on record	4
Bronx, US	3
Glocation not on record	2
Castelar, AR	2
The University of Arizonalocation not on record	2
Valparaiso, CL	2
University of Montpellierlocation not on record	2
Córdoba, AR	2
Vancouver, CA	1
Herbario Universidad de Concepciónlocation not on record	1
Auckland, NZ	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Freie Universität Berlinlocation not on record	1
IANIGLAlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

22 institutions · 92 of 96 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)