Ribes lobbii

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Grossulariaceae/Ribes

At a glance

Occurrence records1 040

Data sources7

Biological traits10

DNA specimens5

eDNA detections3

Sources7 archives

Databases and archives Ribes lobbii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 040 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF1 040 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Ribes lobbii (known commonly by the names gummy gooseberry, fuchsia-flowered gooseberry or pioneer gooseberry) is a shrubby, deciduous, shade-intolerant perennial dicot found on the western coast of North America. It was first described in 1876 by Asa Gray.Amer. Naturalist x. (1876) 274. The specific epithet was a dedication to the English plant collector William Lobb.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass3.21 mg

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ribes lobbii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG235076.1 ↗359 bpCanada · 1893

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTCGGCCGAAGGCACGTCTGCCTGGGCGTCACGTACC …

Ribes lobbii voucher CCDB-18313-A01 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 040 records

Wild obs. + sensor348

Museum / vouchered474

Cultivated / captive3

Other215

Origin

Native1

Range

Area of Occupancy AOO2 352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 189≤1 km 28≤10 km 19>10 km 20

256 georeferenced · 92 without coordinates

Open the mapobservation + sensor348

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 19≤1 km 151≤10 km 115>10 km 14

299 georeferenced · 175 without coordinates

Open the institutions mapphysical evidence474

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Arcata, US	87
Corvallis, US	68
Angwin, US	64
WTUlocation not on record	47
Pullman, US	30
Vancouver, CA	20
Victoria, CA	14
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	10
Claremont, US	8
Portland, US	6
Ashland, US	6
Davis, US	6
Moscow, US	6
Santa Barbara, US	4
Riverside, US	3
Portland, US	2
Tacoma, US	2
Cheney, US	2
Wuzhou, CN	2
University of Stellenboschlocation not on record	2
KNFHClocation not on record	2
Bend, US	2
KNFYlocation not on record	2
Boise, US	1
Chongqing Museumlocation not on record	1
Los Angeles, US	1
San Diego, US	1
AUAlocation not on record	1
University of British Columbia, Herbariumlocation not on record	1
Logan, US	1
Canadian Department of Agriculturelocation not on record	1
Tampa, US	1
Bureau of Land Management, Medford District Officelocation not on record	1
Moscow State Universitylocation not on record	1
St. Paul, US	1
STNFlocation not on record	1
HJAEFlocation not on record	1
University of Alberta Museumslocation not on record	1
DOI/NPS, Mount Rainier National Parklocation not on record	1

39 institutions · 411 of 474 vouchered records shown · 63 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Ribes lobbii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Cut-over area near bluff drive

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter14.2 °C

Max temp (day)13.1 °C

Min temp (night)6.80 °C

Precipitation70.5 mm/mo

Air humidity60.1 %

Moisture balance-16.4 mm/mo

Vapour deficit488 Pa

Wind speed3.60 m/s

Cloud cover45.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ribes lobbii

At a glance

Sources7 archives

Size & morphology1

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Record type1 040 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions24 of 39 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 040 records