Rhytisma americanum

Fungi/Ascomycota/Leotiomycetes/Rhytismatales/Rhytismataceae/Rhytisma

At a glance

Occurrence records1 516

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Rhytisma americanum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 516 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 516 records

DNA & barcodingNCBIsequences

01Narrative

Rhytisma americanum est une espèce de champignons ascomycètes pathogènes. On le trouve en Amérique du Nord sur les feuilles de l'érable rouge, l'érable à sucre, l'érable argenté et l'érable à épis, sur lesquelles il forme des taches noires nommées «taches goudronneuses». Il ne faut pas le confondre avec R. acerinum, que l'on trouve sur les espèces européennes d'érables et qui présente des différences morphologiques.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhytisma americanum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH507271.1 ↗394 bpUSA

ACGT

GCCGGCCCAAAGGCCTCAACTCCTCGAATTTTTGCCGTCCGAGCACAATGTAACAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGG …

Rhytisma americanum isolate NY-3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS6

fungal barcode

08Occurrence & distribution

Record type1 516 records

Wild obs. + sensor1 500

Museum / vouchered16

Range

Area of Occupancy AOO4 336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 884≤1 km 114≤10 km 39>10 km 123

1 160 georeferenced · 340 without coordinates

Open the mapobservation + sensor1 500

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 1≤10 km 8>10 km 1

10 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Catholic University of Pekinglocation not on record	12
Chicago, US	1
Université de Montréal Biodiversity Centrelocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
St. Paul, US	1

5 institutions · 16 of 16 vouchered records shown

At a glance

Sources6 archives

At a glance

Record type1 516 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 5 geolocated

Record type1 516 records