Rhynchosporium secalis

(Oudem.) Davis · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Ploettnerulaceae/Rhynchosporium

At a glance

Occurrence records427

Data sources10

Biological traits0

DNA specimens7

eDNA detections8

Sources10 archives

Databases and archives Rhynchosporium secalis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility427 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF427 records

Environmental DNA2 datasets · 0 countries8 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceGoaT · NCBI49 Mbp

01Narrative

Rhynchosporium secalis is an ascomycete fungus that is the causal agent of barley and rye scald.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhynchosporium secalis has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes2

GenBank sequences9

eDNA detections8

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPQ679019.1 ↗428 bpCanada

ACGT

TTGAATAAACTACCTCTGTTGCTTTGGCAGGCCGCCTAGCGCCAGCGGCTTCGGCTGCTGAGTGCCTGCCAGAGGACCACAACTCTTGTT …

Rhynchosporium secalis isolate APHL-318 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS9

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Rhynchosporium secalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size49 410 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Rhynchosporium secalis0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness97.1% BUSCO

08Occurrence & distribution

Record type427 records

Wild obs. + sensor80

Museum / vouchered341

Cultivated / captive5

Other1

Range

Area of Occupancy AOO972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 78

78 georeferenced · 2 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤1 km 12≤10 km 85>10 km 39

136 georeferenced · 205 without coordinates

Open the institutions mapphysical evidence341

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pullman, US	121
Bernard Price Institute for Palaeontological Researchlocation not on record	109
DPIlocation not on record	49
Auckland, NZ	23
Madison, US	18
Olocation not on record	6
Cincinnati, US	2
TENN-Flocation not on record	2
Catholic University of Pekinglocation not on record	2
TROMlocation not on record	1
Kensington, AU	1
Lincoln, US	1
Chicago, US	1
Uniwersytet Łódzkilocation not on record	1
ILLSlocation not on record	1
Karlsruhe, DE	1
Uppsala, SE	1
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	1

18 institutions · 341 of 341 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Rhynchosporium secalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)