Rhynchosia malacophylla

(Spreng.) Bojer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Rhynchosia

At a glance

Occurrence records146

Data sources10

Biological traits7

DNA specimens20

eDNA detections5

Sources10 archives

Databases and archives Rhynchosia malacophylla's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility146 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF146 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Rhynchosia malacophylla is a species of flowering plant in the genus Rhynchosia, native to Africa (mostly the Horn of Africa and nearby areas), and Yemen. It tends to be a weed in sugarcane plantations.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formscrambling perennial

Life spanperennial

Habitat & environment4

Climateseasonally dry tropical

Climberobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Climber

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhynchosia malacophylla has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes6

GenBank sequences3

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK261211.1 ↗266 bpKenya · 2015

ACGT

TTGTGAACTCCAACCAATTGCCGGTGAATTTGTTTATCACTTGGGATTGGAGACTTGTTGAAGAACATTTCATCCTTTCCTTTGTTGGGG …

Rhynchosia malacophylla voucher B2_K1343 internal transcribed spacer 1 and 5.8S ribosomal intergenic spacer, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★trnL-F★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Rhynchosia malacophylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — FRAHM-LELIVELD, J.A. 1969. Cytotaxonomic notes on African Papilionaceae. Acta Bot. Neerl. 18: 67-73.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type146 records

Wild obs. + sensor8

Museum / vouchered89

Cultivated / captive7

Other42

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 5 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence89

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	21
Saint Louis, US	14
MeiseBGlocation not on record	12
Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record	5
Berlin, DE	4
CJBGlocation not on record	2
Stockholm, SE	1
Bronx, US	1
Yaoundé, CM	1
Xiamen, CN	1
Clocation not on record	1
Wlocation not on record	1
Uppsala, SE	1

13 institutions · 65 of 89 vouchered records shown · 24 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Rhynchosia malacophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

red soil escapmentEscarpment; savanna grassland in black cotto…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 18.2–19.2

Seasonal swing summer↔winter2.60 °C

Max temp (day)23.2 °C 23.2–24.3

Min temp (night)13.2 °C 13.2–13.9

Precipitation55.0 mm/mo 55.0–88.0

Air humidity57.3 % 57.3–57.6

Moisture balance-66.0 mm/mo -66.0–-43.6

Vapour deficit897 Pa 897–946

Wind speed2.40 m/s 2.40–2.50

Cloud cover38.8 % 38.8–41.5

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)