Rhynchoconger ectenurus

(Jordan & Richardson, 1909) · species

image placeholder — illustration coming later

Animalia/Chordata/Anguilliformes/Congridae/Rhynchoconger

At a glance

Occurrence records208

Data sources10

Biological traits6

DNA specimens33

eDNA detections36

Sources10 archives

Databases and archives Rhynchoconger ectenurus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility101 records↗

OBISOcean Biodiversity Information System107 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS208 records

Environmental DNA1 datasets · 2 countries36 detections

DNA & barcodingBOLD33 specimens

01Narrative

Rhynchoconger ectenurus, known commonly as the longnose conger in Australia,Common names of Rhynchoconger ectenurus at www.fishbase.org. is an eel in the family Congridae (conger/garden eels).Rhynchoconger ectenurus at www.fishbase.org. It was described by David Starr Jordan in Robert Earl Richardson in 1909, originally under the genus Leptocephalus.Jordan, D. S. and R. E. Richardson, 1909 [ref. 2493] A catalogue of the fishes of the island of Formosa, or Taiwan, based on the collections of Dr. Hans Sauter. Memoirs of the Carnegie Museum v. 4 (no. 4): 159-204, Pls. 63-74. It is a marine, subtropical eel which is known from the western Pacific Ocean, including northern Australia, Japan, the Korean Peninsula, and the eastern China Sea. It inhabits soft sediments on the continental shelf and slope. Males can reach a maximum total length of 65 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length65 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max500 m

Depth min200 m

Vulnerability46

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhynchoconger ectenurus has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

eDNA detections36

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

2Cmostly conserved

44Gmostly conserved

47Cmostly conserved

49Cmostly conserved

50Amostly conserved

51Gmostly conserved

53Cmostly conserved

54Tmostly conserved

55Amostly conserved

196Cvariable

271Cvariable

340Cvariable

490Avariable

601Amostly conserved

603Cmostly conserved

604Amostly conserved

605Tmostly conserved

607Cmostly conserved

608Tmostly conserved

622Cvariable

CCTTTATCTAGTATTTGGTGCTTGAGCCGGGATGGTGGGGACCGCCCTCAGCCTACTAATTCGAGCTGAGCTAAGCCAACCCGGAGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes5

BIN1

Most divergent pair1.5%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rhynchoconger graciliorsame genus13.2%Rhynchoconger flavussame genus14.1%Bathyuroconger parvibranchialissame family14.3%Bathyuroconger vicinussame family14.6%Bassanago hirsutussame family15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_063503 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND612S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type208 records

Wild obs. + sensor20

Museum / vouchered174

Other14

Origin

Native2

Range

Area of Occupancy AOO232 km²

Depth

0–200 m sunlit17

200–1000 m twilight4

1–4 km midnight0

>4 km abyssal0

median 128 m · max 479 m · 21 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 16 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 17≤1 km 39≤10 km 22>10 km 6

84 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence174

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	34
Kagoshima University Museumlocation not on record	11
CASlocation not on record	9
National Marine Biodiversity Institute of Korealocation not on record	9
Sydney, AU	6
Natick, US	4
Wuzhou, CN	2
Louisiana State University, Museum of Zoologylocation not on record	2
Washington, US	1
CSIRO, Australian National Fish Collectionlocation not on record	1
University of California San Diegolocation not on record	1

11 institutions · 80 of 174 vouchered records shown · 2 without an institution code

09Environmental DNA36 detections

Where the DNA of Rhynchoconger ectenurus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 20.6–25.5

Seasonal swing summer↔winter5.90 °C

Max temp (day)24.6 °C 21.7–26.2

Min temp (night)23.5 °C 19.3–24.9

Precipitation93.5 mm/mo 57.5–190

Air humidity58.8 % 55.3–65.8

Vapour deficit1,233 Pa 1,059–1,315

Cloud cover32.4 % 21.1–48.0

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)