Rhynchocinetes durbanensis

Gordon, 1936 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Rhynchocinetidae/Rhynchocinetes

At a glance

Occurrence records572

Data sources7

Biological traits3

DNA specimens16

eDNA detections6

Sources7 archives

Databases and archives Rhynchocinetes durbanensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility539 records↗

OBISOcean Biodiversity Information System33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS572 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD16 specimens

01Narrative

Rhynchocinetes durbanensis, commonly known as the camel shrimp and the hingebeak prawn, is a species of shrimp (family Rhynchocinetidae) found in the Indo-Pacific. Up to 4 cm in length, the shrimp has large black eyes, and features red and white lines on a translucent body. It has many white ocelli (spots) as well as a Y-shaped white mark on the upper front part of its carapace. It is strongly sexually dimorphic, and dominant males have larger first pair of chelipeds. The shrimp is found in hollows and crevices from 5 to deep, where it forms groups consisting of dozens of individuals. One study determined that the ovigerous females carry from 267 to 1764 eggs, and the eggs take 9 days to hatch after spawning at a temperature of 29.2 C, or 18 days when the temperature is under 22.0 C. R. durbanensis has been frequently confused with R. uritai, and also closely resembles R. brucei. R. durbanensis was first described scientifically by Isabella Gordon in 1936.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length4 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhynchocinetes durbanensis has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes12

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.20%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 2 variable positions, in barcode order

481Avariable

634Gvariable

CTTATATTTCATTTTCGGTGCCTGAGCAGGAGTTTTAGGGACCGGATTAAGACTTTTAATTCGAGCCGAACTTGGTCAACCAGGAAGCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rhynchocinetes bruceisame genus15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_029372 ↗ · 13 protein · 24 tRNA · 2 rRNA

COX1COX2ATP6COX3ND3ND5ND4ND4LND6CYTBND1ATP8ND216S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

07Deep time~277 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin277 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard periods (Jurassic, Cretaceous…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. The dashed rules marked ✦ are the five great mass extinctions. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock originmass extinction

08Occurrence & distribution

Record type572 records

Wild obs. + sensor534

Museum / vouchered38

Range

Area of Occupancy AOO1 148 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 16 m · max 16 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 142≤1 km 198≤10 km 79>10 km 24

443 georeferenced · 91 without coordinates

Open the mapobservation + sensor534

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤1 km 2≤10 km 6>10 km 1

9 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	8
Sydney, AU	6
Frankfurt am Main	4
Brussels, BE	1
RBINS-Scientific Heritagelocation not on record	1

5 institutions · 20 of 38 vouchered records shown · 2 without an institution code

09Environmental DNA6 detections

Where the DNA of Rhynchocinetes durbanensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 16.4–23.8

Seasonal swing summer↔winter3.80 °C

Max temp (day)26.8 °C 20.1–26.8

Min temp (night)20.9 °C 12.3–20.9

Precipitation216 mm/mo 83.4–216

Air humidity70.2 % 59.2–70.2

Moisture balance94.8 mm/mo 7.80–94.8

Vapour deficit873 Pa 753–873

Wind speed4.00 m/s 2.60–4.00

Cloud cover31.4 % 31.4–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)