Rhopalus subrufus

(Gmelin, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Rhopalidae/Rhopalus

At a glance

Occurrence records32 898

Data sources7

Biological traits0

DNA specimens49

eDNA detections61

Sources7 archives

Databases and archives Rhopalus subrufus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility32 898 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI61 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF32 898 records

Environmental DNA3 datasets · 8 countries61 detections

DNA & barcodingBOLD49 specimens

01Narrative

Rhopalus subrufus is a species of scentless plant bugs belonging to the family Rhopalidae, subfamily Rhopalinae. It is found in most of Europe, but not Ireland and northern Scandinavia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhopalus subrufus has left across the world's sequence archives.

At a glance

DNA specimens49

BINs2

Marker genes1

eDNA detections61

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus48 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 79 variable positions, in barcode order

43Tmostly conserved

64Tmostly conserved

67Tmostly conserved

74Tmostly conserved

79Tmostly conserved

91Amostly conserved

97Cmostly conserved

106Tmostly conserved

115Tmostly conserved

118Cmostly conserved

133Gmostly conserved

136Tmostly conserved

139Amostly conserved

154Tmostly conserved

160Gmostly conserved

163Cmostly conserved

169Gmostly conserved

181Amostly conserved

184Tmostly conserved

205Amostly conserved

211Amostly conserved

214Tmostly conserved

217Amostly conserved

223Tmostly conserved

226Tmostly conserved

232Amostly conserved

247Tmostly conserved

259Cmostly conserved

263Tmostly conserved

283Amostly conserved

284Cmostly conserved

289Gmostly conserved

302Amostly conserved

313Gmostly conserved

316Amostly conserved

322Gmostly conserved

328Tmostly conserved

334Tmostly conserved

337Amostly conserved

347Cmostly conserved

355Cmostly conserved

364Tmostly conserved

373Amostly conserved

376Cmostly conserved

385Cmostly conserved

400Cmostly conserved

406Tmostly conserved

407Tmostly conserved

418Cmostly conserved

421Tmostly conserved

437Amostly conserved

448Cmostly conserved

463Tmostly conserved

478Cmostly conserved

484Cmostly conserved

523Cmostly conserved

529Tmostly conserved

548Tmostly conserved

550Amostly conserved

559Amostly conserved

562Amostly conserved

578Tmostly conserved

586Amostly conserved

589Tmostly conserved

592Tmostly conserved

598Tmostly conserved

601Cmostly conserved

604Gmostly conserved

607Amostly conserved

610Tmostly conserved

616Cmostly conserved

622Amostly conserved

625Gmostly conserved

628Amostly conserved

631Gmostly conserved

634Tmostly conserved

641Cmostly conserved

646Tmostly conserved

649Gmostly conserved

AACATTATACTTTATTTTTGGTATATGAGCCGGAATAGTAGGTTCATCATTAAGATGAATTATTCGTATTGAATTAGGTCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes10

BINs2

Most divergent pair2.1%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rhopalus distinctussame genus1.6%Rhopalus conspersussame genus11.4%Corizus hyoscyamisame family12.3%Harmostes reflexulussame family13.1%Nysius vinitorsame order14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type32 898 records

Wild obs. + sensor32 097

Museum / vouchered665

Cultivated / captive1

Other135

Range

Area of Occupancy AOO46 048 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 10 502≤1 km 3 354≤10 km 13 569>10 km 300

27 725 georeferenced · 4 372 without coordinates

Open the mapobservation + sensor32 097

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 107≤1 km 185≤10 km 200>10 km 1

493 georeferenced · 172 without coordinates

Open the institutions mapphysical evidence665

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	99
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	55
Tartu, EE	49
Philadelphia, US	46
Provincia di Livornolocation not on record	37
SLU Artdatabankenlocation not on record	27
Bonn, DE	22
ZMAAlocation not on record	16
neflocation not on record	9
CBDClocation not on record	9
WGSlocation not on record	8
Adam Mickiewicz University in Poznańlocation not on record	7
Jyväskylä, FI	6
BioFokuslocation not on record	6
UO-CeStuBiolocation not on record	5
Tallinn, EE	4
Barcelona, ES	3
South Kensington, GB	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	3
Tromsø, NO	3
ZSMlocation not on record	2
Helsinki, FI	2
Metsähallituslocation not on record	2
CIBIOlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Winterthur, CH	1
Natural History Museum Rotterdamlocation not on record	1
IMEDEAlocation not on record	1

28 institutions · 428 of 665 vouchered records shown · 237 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA61 detections

Where the DNA of Rhopalus subrufus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found61

Studies independent surveys3

Countries8

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 61 detections have coordinates

Open the map8 countries0

Affleurements et rochers erodes a vegetation…Fourres, ronciers et lisieres forestieresAlpages et prairies humidesCity parks and large gardensOlive orchardMaquis en friches en bord de cour d'eau

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 10.5–20.2

Seasonal swing summer↔winter17.2 °C

Max temp (day)19.2 °C 14.7–23.5

Min temp (night)11.4 °C 6.60–15.4

Precipitation64.9 mm/mo 39.8–166

Air humidity60.6 % 55.8–63.1

Moisture balance-34.9 mm/mo -108–66.5

Vapour deficit706 Pa 536–948

Wind speed3.50 m/s 1.70–4.60

Cloud cover40.5 % 35.3–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Rhopalus subrufus

At a glance

Sources7 archives

At a glance

Record type32 898 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 28 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type32 898 records