Rhopalum coarctatum

(Scopoli, 1763) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Crabronidae/Rhopalum

At a glance

Occurrence records3 385

Data sources9

Biological traits0

DNA specimens35

eDNA detections61

Sources9 archives

Databases and archives Rhopalum coarctatum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 385 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI61 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 385 records

Environmental DNA4 datasets · 8 countries61 detections

DNA & barcodingBOLD35 specimens

Genome at a glanceGoaT · NCBI≈282 Mbp

01Narrative

Rhopalum coarctatum is a Palearctic species of solitary wasp.BWARSEdward Saunders 1896, The Hymenoptera Aculeata of the British Isles London. pdf us.archive Full text with illustrations]

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhopalum coarctatum has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

eDNA detections61

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

232Tmostly conserved

316Gmostly conserved

340Cmostly conserved

361Cmostly conserved

625Tmostly conserved

ATTATATTTTATTTTTGCTATTTGATCAGGTATATTAGGTACTTCTTTAAGAATAATTATTCGAATAGAATTGGGAATGGCGGGACAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.22%

Haplotypes6

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rhopalum gracilesame genus9.3%Rhopalum austriacumsame genus10.3%Podagritus albipessame family11.1%Crossocerus nigritussame family11.6%Rhopalum clavipessame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Rhopalum coarctatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈281 855 425 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Rhopalum coarctatum0.28 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.6% BUSCO

08Occurrence & distribution

Record type3 385 records

Wild obs. + sensor1 410

Museum / vouchered1 965

Other10

Range

Area of Occupancy AOO5 908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 668≤1 km 269≤10 km 404>10 km 5

1 346 georeferenced · 64 without coordinates

Open the mapobservation + sensor1 410

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 333≤1 km 357≤10 km 1 044>10 km 16

1 750 georeferenced · 215 without coordinates

Open the institutions mapphysical evidence1 965

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	1 042
SLU Artdatabankenlocation not on record	164
Provincia di Livornolocation not on record	92
Zürich, CH	81
John May Museum of Natural Historylocation not on record	72
Philadelphia, US	64
University of Guelphlocation not on record	59
NHMOlocation not on record	49
Natural History Museum Rotterdamlocation not on record	44
Tilburg, NL	27
NMOKlocation not on record	21
Metsähallituslocation not on record	20
neflocation not on record	16
MZLUlocation not on record	16
BioFokuslocation not on record	15
Trondheim, NO	15
Tartu, EE	13
WIlocation not on record	10
Uniwersytet Łódzkilocation not on record	7
ZSMlocation not on record	6
Gothenburg, SE	5
Stockholm, SE	5
ZMAAlocation not on record	4
South Kensington, GB	4
Edmonton, CA	3
CBDClocation not on record	3
Natural History Museum, Londonlocation not on record	3
Centre for Biodiversity Genomicslocation not on record	2
DFlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
University of Central Floridalocation not on record	1
NCMGlocation not on record	1
Vancouver, CA	1

33 institutions · 1 867 of 1 965 vouchered records shown · 98 without an institution code

09Environmental DNA61 detections

Where the DNA of Rhopalum coarctatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found61

Studies independent surveys4

Countries8

Verifiable raw sequence linked31

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 61 detections have coordinates

Open the map8 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 13.2–21.6

Seasonal swing summer↔winter19.8 °C

Max temp (day)20.7 °C 16.2–26.1

Min temp (night)12.8 °C 9.40–15.4

Precipitation71.1 mm/mo 56.0–96.8

Air humidity59.0 % 55.8–61.3

Moisture balance-40.3 mm/mo -83.9–2.50

Vapour deficit772 Pa 576–1,144

Wind speed2.50 m/s 1.60–4.10

Cloud cover43.0 % 33.2–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 61 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Rhopalum coarctatum

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 385 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 385 records