Rhodotorula glutinis

(Fresen.) F.C.Harrison · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Microbotryomycetes/Sporidiobolales/Sporidiobolaceae/Rhodotorula

At a glance

Occurrence records84

Data sources11

Biological traits0

DNA specimens72

eDNA detections78

Sources11 archives

Databases and archives Rhodotorula glutinis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility84 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI78 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics72 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS112 compounds

Occurrence & distributionGBIF84 records

Environmental DNA7 datasets · 14 countries78 detections

DNA & barcodingBOLD · NCBI72 specimens

Genome at a glanceGoaT · NCBI20 Mbp

01Narrative

Rhodotorula glutinis is the type species of the genus Rhodotorula, a basidiomycetous genus of pink yeasts which contains 370 species. Heterogeneity of the genus has made its classification difficult with five varieties having been recognized; however, as of 2011, all are considered to represent a single taxon. The fungus is a common colonist of animals, foods and environmental materials. It can cause opportunistic infections, notably blood infection in the setting of significant underlying disease. It has been used industrially in the production of carotenoid pigments and as a biocontrol agent for post-harvest spoilage diseases of fruits.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition112 compounds

Compounds documented for Rhodotorula glutinis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Chamigrane sesquiterpenoids19

Laurane sesquiterpenoids9

Secochamigrane sesquiterpenoids6

Fatty alcohols5

Unsaturated fatty acids5

Documented compounds112 total

Tissue Source Quantified only

Compound	Amount	Source
(18E)-2,6,10,14,19,23,27,31-octamethyldotriaconta-2,6,10,14,16,18,22,26,30-nonaene	present	LOTUS
(1R,1'S,2'S,5R,6S)-2',3-dibromo-1'-chloro-1',4,4,6-tetramethylspiro[7-oxabicyclo[4.1.0]hept-2-ene-5,4'-cyclohexane]	present	NPASS
(1R,1'S,4'S,5R,5'S,6S)-3,4'-dibromo-5'-chloro-4,4,5',6-tetramethylspiro[7-oxabicyclo[4.1.0]hept-2-ene-5,2'-cyclohexane]-1'-ol	present	NPASS
(1R,3R,5R,6R,8R)-5-bromo-3-[(1S)-1-bromopropyl]-8-[(Z)-pent-2-en-4-ynyl]-2,7-dioxabicyclo[4.2.1]nonane	present	NPASS
(1R,3R,5R,6R,8S)-5-bromo-3-[(1S)-1-bromopropyl]-8-[(Z)-pent-2-en-4-ynyl]-2,7-dioxabicyclo[4.2.1]nonane	present	NPASS
(1R,3R,6S,8R,11R)-8-bromo-4,11,12,12-tetramethyl-7-oxatricyclo[6.3.1.01,6]dodeca-4,9-diene-3,11-diol	present	NPASS
(1R,4E,6S)-1-methyl-4-(6-methylhept-5-en-2-ylidene)-7-oxabicyclo[4.1.0]heptane	present	NPASS
(1R,5R,7S)-9-bromo-8,8-dimethyl-11-methylidene-5-prop-1-en-2-yl-2,4-dioxabicyclo[5.3.1]undec-9-ene	present	NPASS
(1R,5S,7R,8S)-8-chloro-2,2,5,8-tetramethyl-6-oxatricyclo[5.3.1.01,5]undec-3-ene-3-carbaldehyde	present	NPASS
(1R,6S,8R,11R)-3,8-dibromo-4,11,12,12-tetramethyl-7-oxatricyclo[6.3.1.01,6]dodeca-3,9-dien-11-ol	present	NPASS

05DNA & barcoding72 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhodotorula glutinis has left across the world's sequence archives.

At a glance

DNA specimens72

Marker genes6

GenBank sequences10

eDNA detections78

Countries17

The DNA barcodea real sequence read deposited for this species

ITSPX487953.1 ↗326 bpRomania · 2022

ACGT

ATGAATGTATGCAAATTTAAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAC …

Rhodotorula glutinis isolate Romania140 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS228S-D1-D25-8S

animal barcodefungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Rhodotorula glutinis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size20 090 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Rhodotorula glutinis0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness85.8% BUSCO

08Occurrence & distribution

Record type84 records

Wild obs. + sensor4

Museum / vouchered68

Cultivated / captive12

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1>10 km 1

2 georeferenced · 2 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence68

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the mapnot free-living12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Annamalai University, Faculty of Marine Scienceslocation not on record	6
Guasave, MX	2
BASElocation not on record	1

3 institutions · 9 of 68 vouchered records shown · 55 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA78 detections

Where the DNA of Rhodotorula glutinis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found78

Studies independent surveys7

Countries14

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 78 detections have coordinates

Open the map14 countries0

ocean; watercoastal habitatfruitsoil

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 12.5–25.1

Seasonal swing summer↔winter13.1 °C

Max temp (day)23.9 °C 16.1–30.5

Min temp (night)15.2 °C 8.10–19.3

Precipitation90.3 mm/mo 18.6–142

Air humidity58.6 % 52.0–64.9

Moisture balance-17.8 mm/mo -116–5.70

Vapour deficit939 Pa 563–1,616

Wind speed2.50 m/s 1.80–5.90

Cloud cover33.4 % 12.9–50.3

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)