Rhodophana nitellina

(Fr.) Papetti · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Entolomataceae/Rhodophana

At a glance

Occurrence records1 797

Data sources8

Biological traits0

DNA specimens7

eDNA detections24

Sources8 archives

Databases and archives Rhodophana nitellina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 797 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 797 records

Environmental DNA4 datasets · 8 countries24 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

De oranje zalmplaat is een schimmel behorend tot de familie Entolomataceae. Hij leeft saprotroof in kleine groepen in humus van loof- en gemengde bossen op matig vochtig, voedselrijk, kalkrijk zand of leem.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhodophana nitellina has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

GenBank sequences2

eDNA detections24

Countries8

The DNA barcodea real sequence read deposited for this species

ITSPP335762.1 ↗726 bpUSA · 2023

ACGT

GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAATTCTGGTATGGTTGTTGCTGGTTCTCTGGAGCATTGT …

Rhodophana nitellina voucher HAY-F-006681 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type1 797 records

Wild obs. + sensor1 451

Museum / vouchered317

Other29

Range

Area of Occupancy AOO4 196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 520≤1 km 218≤10 km 519>10 km 11

1 268 georeferenced · 183 without coordinates

Open the mapobservation + sensor1 451

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 101≤1 km 76≤10 km 58>10 km 10

245 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence317

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	70
Olocation not on record	57
Oulu, FI	16
Trondheim, NO	15
TROMlocation not on record	13
BDBClocation not on record	13
SLU Artdatabankenlocation not on record	12
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	10
nsnflocation not on record	9
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	9
Zürich, CH	7
TUR-Alocation not on record	5
Salzburg, AT	3
Turku, FI	3
MUSE - Museo delle Scienze di Trentolocation not on record	3
University of Oslo, Natural History Museumlocation not on record	2
WU-MYClocation not on record	2
Denver, US	2
Trondheim, NO	1
Toronto, CA	1
Uppsala, SE	1
Mérida, ES	1
Gijón, ES	1
LDlocation not on record	1
IB FRC Komi SC UB RASlocation not on record	1
CJBGlocation not on record	1
Kuopio, FI	1

27 institutions · 260 of 317 vouchered records shown · 57 without an institution code

09Environmental DNA24 detections

Where the DNA of Rhodophana nitellina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys4

Countries8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map8 countries0

NearcticPalearcticTourbiere, pres d un petit aulne

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.40

Conductivity30.0 µS/cm

Organic carbon3.32 %

Water content18.8 %

Phosphorus18.0 mg/kg

Clay31.6 %

Sand43.0 %

Depth0.2 m

SoilTenosols

1 sample with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 6.30–17.4

Seasonal swing summer↔winter22.0 °C

Max temp (day)15.1 °C 8.60–21.2

Min temp (night)9.30 °C 1.60–13.2

Precipitation87.0 mm/mo 55.5–160

Air humidity61.0 % 59.9–64.6

Moisture balance12.2 mm/mo -33.4–77.7

Vapour deficit559 Pa 319–777

Wind speed2.90 m/s 1.50–6.50

Cloud cover38.9 % 33.4–57.5

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Rhodophana nitellina

At a glance

Sources8 archives

At a glance

Record type1 797 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 797 records