Rhodocollybia laulaha

Desjardin, Halling & Hemmes · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Omphalotaceae/Rhodocollybia

At a glance

Occurrence records26

Data sources8

Biological traits0

DNA specimens2

eDNA detections3

Sources8 archives

Databases and archives Rhodocollybia laulaha's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility26 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF26 records

Environmental DNA2 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Rhodocollybia laulaha is a species of fungus in the family Marasmiaceae. Found in Hawaii, it was described as new to science in 1999 by mycologists Dennis Desjardin, Roy Halling, and Don Hemmes. The fruitbodies have caps that are 3 to in diameter, bell-shaped to convex in shape, and light brown (young specimens) to grayish orange or orange-white (old specimens). Gills have an adnexed attachment to the stipe, and are narrow and very crowded together. The stipe is 3 to long by 0.6 to thick. The specific epithet laulaha—Hawaiian for "widespread"—refers to its widespread distribution and common appearance on the Hawaiian Islands.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhodocollybia laulaha has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU369957.1 ↗561 bpUSA

ACGT

TTTTTTTCTTTCTTTCTTCGCTTTTCATCCACCTGTGCACTTTTTGTAGAAGTTCTTGTTGTTCAGATGAGACTTCTATGTTCTTTACAA …

Rhodocollybia laulaha voucher F:MRK54 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type26 records

Wild obs. + sensor24

Museum / vouchered2

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 11≤1 km 4≤10 km 2>10 km 2

19 georeferenced · 5 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
TENN-Flocation not on record	1

1 institutions · 1 of 2 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Rhodocollybia laulaha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.4 °C 23.4–23.4

Seasonal swing summer↔winter3.30 °C

Max temp (day)24.6 °C

Min temp (night)22.6 °C

Precipitation116 mm/mo

Air humidity58.6 %

Moisture balance-39.5 mm/mo

Vapour deficit1,188 Pa

Wind speed5.10 m/s

Cloud cover37.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)