Rhizopus stolonifer

(Ehrenb.) Vuill. · species

image placeholder — illustration coming later

Fungi/Mucoromycota/Mucoromycetes/Mucorales/Rhizopodaceae/Rhizopus

At a glance

Occurrence records795

Data sources13

Biological traits0

DNA specimens20

eDNA detections193

Sources13 archives

Databases and archives Rhizopus stolonifer's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility573 records↗

OBISOcean Biodiversity Information System222 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI193 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS120 compounds

Occurrence & distributionGBIF · OBIS795 records

Environmental DNA5 datasets · 9 countries193 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceGoaT · NCBI≈48 Mbp

01Narrative

Rhizopus stolonifer is commonly known as black bread mold. It is a member of Zygomycota and considered the most important species in the genus Rhizopus. It is one of the most common fungi in the world and has a global distribution although it is most commonly found in tropical and subtropical regions. It is a common agent of decomposition of stored foods. Like other members of the genus Rhizopus, R. stolonifer grows rapidly, mostly in indoor environments.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition120 compounds

Compounds documented for Rhizopus stolonifer across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones6

Flavonols4

Dicarboxylic acids3

Furofuranoid lignans2

Apocarotenoids(ε-)2

Documented compounds120 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Osbeckic acid	present	NPASS
(+)-Syringaresinol	present	NPASS
(3R,3aR,6R,6aS)-3,6-bis(4-hydroxy-3-methoxyphenyl)-3,3a,6,6a-tetrahydro-1H-furo[3,4-c]furan-4-one	present	NPASS
(3S,5R,7R,8R,9S,10S,13S,14S)-3,7-Dihydroxy-10,13-Dimethyl-1,2,3,4,5,6,7,8,9,11,12,14,15,16-Tetradecahydrocyclopenta[A]Phenanthren-17-One	present	NPASS
(3S,5R,8R,9S,10S,13S,14S)-3-Hydroxy-10,13-Dimethyl-2,3,4,5,6,8,9,11,12,14,15,16-Dodecahydro-1H-Cyclopenta[A]Phenanthrene-7,17-Dione	present	NPASS
(4E)-5-[(1S)-1-hydroxy-2,6,6-trimethyl-4-oxocyclohex-2-en-1-yl]-3-methylpenta-2,4-dienoic acid	present	LOTUS
2-(3,4-dihydroxyphenyl)-5-hydroxy-7-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-[[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	NPASS
4-Hydroxybenzoic acid	present	NPASS
5-Hydroxymethyl-2-furoic acid	present	NPASS
5Alpha-Androstane-3Alpha,11Beta,17Beta-Triol	present	NPASS

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhizopus stolonifer has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes4

GenBank sequences10

eDNA detections193

Countries9

The DNA barcodea real sequence read deposited for this species

ITSPZ359898.1 ↗526 bpViet Nam · 2025

ACGT

AAGGATCATTAATTATGTTAAAGCGCCTTACCTCTTAGGGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAAAATTTGGCTGAGA …

Rhizopus stolonifer isolate RS02 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS25-8S

fungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Rhizopus stolonifer carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈48 208 381 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Rhizopus stolonifer0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness78.3% BUSCO

08Occurrence & distribution

Record type795 records

Wild obs. + sensor183

Museum / vouchered605

Cultivated / captive3

Other4

Range

Area of Occupancy AOO1 584 km²

Depth

0–200 m sunlit148

200–1000 m twilight15

1–4 km midnight3

>4 km abyssal2

median 5 m · max 5 367 m · 168 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 77≤1 km 17≤10 km 40>10 km 19

153 georeferenced · 30 without coordinates

Open the mapobservation + sensor183

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤100 m 2≤10 km 31>10 km 12

45 georeferenced · 560 without coordinates

Open the institutions mapphysical evidence605

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ILLSlocation not on record	36
DPIlocation not on record	34
Bronx, US	18
Auckland, NZ	6
Annamalai University, Centre of Advanced Study in Marine Biologylocation not on record	4
Uppsala, SE	3
Museo Entomologico de Leonlocation not on record	2
Karlsruhe, DE	2
UAclocation not on record	1
Pullman, US	1
National Institute of Biological Resourceslocation not on record	1
FLASlocation not on record	1
Entomological Society of Latvialocation not on record	1
National Museum of Natural Sciencelocation not on record	1

14 institutions · 111 of 605 vouchered records shown · 268 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA193 detections

Where the DNA of Rhizopus stolonifer was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found193

Studies independent surveys5

Countries9

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 193 detections have coordinates

Open the map9 countries0

Afrotropicmarine sediments

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median29.4 °C 25.0–29.4

Seasonal swing summer↔winter6.70 °C

Max temp (day)34.1 °C 29.1–34.1

Min temp (night)24.4 °C 19.3–24.4

Precipitation139 mm/mo 109–139

Air humidity58.3 % 58.3–65.3

Moisture balance-51.0 mm/mo -51.0–37.8

Vapour deficit1,711 Pa 969–1,711

Wind speed2.20 m/s 2.10–2.20

Cloud cover19.6 % 19.6–25.6

CHELSA 1981–2010, ~9 km grid, at location & month of 182 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)