Rhizopogon villosulus

Zeller · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Rhizopogonaceae/Rhizopogon

At a glance

Occurrence records165

Data sources9

Biological traits0

DNA specimens15

eDNA detections30

Sources9 archives

Databases and archives Rhizopogon villosulus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility165 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF165 records

Environmental DNA3 datasets · 6 countries30 detections

DNA & barcodingBOLD · NCBI15 specimens

Genome at a glanceGoaT · NCBI≈33 Mbp

01Narrative

Rhizopogon villosulus is an ectomycorrhizal fungus used as a soil inoculant in agriculture and horticulture. It was first described scientifically by mycologist Sanford Myron Zeller in 1941.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhizopogon villosulus has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes2

GenBank sequences10

eDNA detections30

Countries6

The DNA barcodea real sequence read deposited for this species

ITSMZ429903.1 ↗422 bpUSA

ACGT

AATCGGAAAGCTGTCGCTGGCCCTCTGGGCATGTGCACGCCGACCGTGTTTCATAAATTTCTCACCTGTGAACCTAATGTAGGATGCCTC …

Rhizopogon villosulus voucher RM-157 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Rhizopogon villosulus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈33 267 124 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Rhizopogon villosulus0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness60.1% BUSCO

08Occurrence & distribution

Record type165 records

Wild obs. + sensor32

Museum / vouchered133

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy29% within 1 km

≤100 m 5≤1 km 3≤10 km 14>10 km 6

28 georeferenced · 4 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 8≤10 km 10

20 georeferenced · 113 without coordinates

Open the institutions mapphysical evidence133

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BDBClocation not on record	36
Ann Arbor, US	34
San Sebastián, ES	6
Bronx, US	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
WTUlocation not on record	3
Museo Entomologico de Leonlocation not on record	3
Karlsruhe, DE	2
Bernard Price Institute for Palaeontological Researchlocation not on record	2
Philadelphia, US	2
Pullman, US	1
Gijón, ES	1
Vancouver, CA	1
Chicago, US	1
Mlocation not on record	1
Auckland, NZ	1
MeiseBGlocation not on record	1
FLASlocation not on record	1
Tartu, EE	1
Canberra, AU	1
Staten Island, US	1
Zürich, CH	1
Copenhagen, DK	1
DPIlocation not on record	1

24 institutions · 109 of 133 vouchered records shown · 24 without an institution code

09Environmental DNA30 detections

Where the DNA of Rhizopogon villosulus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys3

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map6 countries0

NearcticNeotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 6.80–22.7

Seasonal swing summer↔winter19.2 °C

Max temp (day)17.6 °C 11.8–25.6

Min temp (night)9.40 °C 2.10–18.9

Precipitation74.9 mm/mo 41.9–215

Air humidity60.6 % 43.7–65.8

Moisture balance-9.90 mm/mo -84.7–81.8

Vapour deficit651 Pa 395–1,152

Wind speed2.50 m/s 1.90–4.10

Cloud cover39.7 % 22.1–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)