Rhizopogon subcaerulescens

A.H.Sm. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Rhizopogonaceae/Rhizopogon

At a glance

Occurrence records88

Data sources7

Biological traits0

DNA specimens1

eDNA detections2

Sources7 archives

Databases and archives Rhizopogon subcaerulescens's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility88 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF88 records

Environmental DNA2 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Rhizopogon subcaerulescens is an ectomycorrhizal fungus used as a soil inoculant in agriculture and horticulture. The species was described by American mycologist Alexander H. Smith in a 1966 publication.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhizopogon subcaerulescens has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY558804.1 ↗235 bpUSA

ACGT

CATTAACGAATATAATTCGAGGGGTTGTCGCTGGCCTCGCTCGCGCGAGGCATGTGCACGCTTCTCGTTTTTCTCTCAACTCACCTGTGC …

Rhizopogon subcaerulescens isolate TK163 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

08Occurrence & distribution

Record type88 records

Wild obs. + sensor3

Museum / vouchered85

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤1 km 9≤10 km 24>10 km 2

35 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence85

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	52
University of Tennessee at Chattanoogalocation not on record	23
Museo Entomologico de Leonlocation not on record	3
Bronx, US	2
Denver, US	1
Pullman, US	1
Chicago, US	1
WTUlocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1

9 institutions · 85 of 85 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Rhizopogon subcaerulescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)