Rhizophagus irregularis

(Błaszk., Wubet, Renker & Buscot) C.Walker & A.Schüßler · species

image placeholder — illustration coming later

Fungi/Glomeromycota/Glomeromycetes/Glomerales/Glomeraceae/Rhizophagus

At a glance

Occurrence records666

Data sources8

Biological traits0

DNA specimens249

eDNA detections746

Sources8 archives

Databases and archives Rhizophagus irregularis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility666 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI746 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics249 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF666 records

Environmental DNA8 datasets · 23 countries746 detections

DNA & barcodingBOLD · NCBI249 specimens

Genome at a glanceGoaT · NCBI153 Mbp

01Narrative

Rhizophagus irregularis est un champignon mycorhizien arbusculaire appartenant au genre Rhizophagus. Il est utilisé comme un inoculât du sol en agriculture et en horticulture.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding249 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhizophagus irregularis has left across the world's sequence archives.

At a glance

DNA specimens249

Marker genes5

GenBank sequences10

eDNA detections746

Countries23

The DNA barcodea real sequence read deposited for this species

ITSPZ226257.1 ↗776 bpIndia · 2025

ACGT

ATGCGACCATATCATGTGGTTTCGTGTCCATAAATTTTTCATGATTTGACCTCAAATCAGGTAGGAACACCCGCTGAACTTAAGCATATC …

Rhizophagus irregularis isolate 2 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

EuropeN.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10atp6COIICOXIII

animal barcodefungal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_014489 ↗ · 30 protein · 25 tRNA · 2 rRNA

orf202cox2atp8orf110atp9orf126orf201orf143orf122nad5orf148cobnad4nad1nad4Lorf140cox1orf327orf237orf276orf106atp6nad2nad3nad6cox3+6

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Rhizophagus irregularis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size153 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Rhizophagus irregularis0.15 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness92.1% BUSCO

08Occurrence & distribution

Record type666 records

Wild obs. + sensor59

Museum / vouchered607

Range

Area of Occupancy AOO476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 59 records without

Open the mapobservation + sensor59

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 606 without coordinates

Open the institutions mapphysical evidence607

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CA	4
Corporación Colombiana de Investigación Agropecuaria - AGROSAVIAlocation not on record	1
UAclocation not on record	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1

4 institutions · 7 of 607 vouchered records shown · 546 without an institution code

09Environmental DNA746 detections

Where the DNA of Rhizophagus irregularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found746

Studies independent surveys8

Countries23

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 746 detections have coordinates

Open the map23 countries0

root organ culture (carrot roots)NearcticPalearcticNeotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature19.0 °C 10.0–29.0

pH6.70 3.60–9.50

Conductivity109 µS/cm 10.0–164,800

Organic carbon1.41 % 0.004–16.3

Water content13.3 % 0.816–88.1

Nitrate-N6.00 mg/kg 0.5–220

Phosphorus20.0 mg/kg 2.00–193

Clay18.5 % 0.91–67.0

Sand61.6 % 0–96.1

Depth0 m 0–0.9

SoilMarineKurosolVertosolCalcarosolChromosolTenosolPodosol

254 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 6.20–24.9

Seasonal swing summer↔winter14.0 °C

Max temp (day)21.0 °C 10.3–31.2

Min temp (night)10.8 °C 3.80–18.5

Precipitation56.9 mm/mo 11.9–97.6

Air humidity57.1 % 45.9–62.5

Moisture balance-67.2 mm/mo -137–28.1

Vapour deficit769 Pa 449–1,624

Wind speed3.30 m/s 2.40–4.50

Cloud cover24.5 % 11.8–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 428 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)