Rhizoctonia fragariae — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Ceratobasidiaceae/Rhizoctonia

At a glance

Occurrence records0

Data sources4

Biological traits0

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Rhizoctonia fragariae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

DNA & barcodingNCBIsequences

01Narrative

Rhizoctonia fragariae é uma espécie de fungo pertencente à família Ceratobasidiaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhizoctonia fragariae has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPP073532.1 ↗518 bpTurkey

ACGT

AGTCGGTTGTCGCTGGCTGTCTTTGGCAGCATGTGCACGCCTTCAGTCTGCTAAATTCATATACAAACTCATTTAATTGAACTGAATGTA …

Rhizoctonia fragariae strain OTU98 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode