Rhizocarpon viridiatrum

(Wulfen) Körb. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Rhizocarpales/Rhizocarpaceae/Rhizocarpon

At a glance

Occurrence records801

Data sources9

Biological traits1

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Rhizocarpon viridiatrum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility801 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Chemical compositionNPASS2 compounds

Occurrence & distributionGBIF801 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Rhizocarpon viridiatrum is a species of lichen in the family Rhizocarpaceae. It was first described by Franz Xaver Freiherr von Wulfen as Lichen viridiater in 1791. Gustav Wilhelm Körber transferred it to the genus Rhizocarpon in 1855.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

03Chemical composition2 compounds

Compounds documented for Rhizocarpon viridiatrum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Piperidine alkaloids $ Steroidal alkaloids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(3S,3'R,3'aS,6'S,6aS,6bR,7'aR,9R,11aS,11bS)-3-hydroxy-3',6',10,11b-tetramethylspiro[1,2,3,4,6,6a,6b,7,8,11a-decahydrobenzo[a]fluorene-9,2'-3a,4,5,6,7,7a-hexahydro-3H-furo[3,2-b]pyridine]-11-one		present	NPASS
Jervine		present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhizocarpon viridiatrum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences6

eDNA detections3

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPV665089.1 ↗509 bpUSA · 2014

ACGT

CATTATTGAGATGGGGGCCTCGCGTCCCCGGACCTCCAACCCGTGCGTACCGTGCCACCGTTGCTTTGGCGGGCTGGCCCCCCGGTGCCG …

Rhizocarpon viridiatrum voucher McCune, B., McCune 34748 (OSU) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6★ITS1

fungal barcode

08Occurrence & distribution

Record type801 records

Wild obs. + sensor342

Museum / vouchered457

Other2

Origin

Native4

Range

Area of Occupancy AOO2 388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 111≤1 km 68≤10 km 146>10 km 8

333 georeferenced · 9 without coordinates

Open the mapobservation + sensor342

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 33≤1 km 51≤10 km 65>10 km 14

163 georeferenced · 294 without coordinates

Open the institutions mapphysical evidence457

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	194
Uppsala, SE	32
Canberra, AU	31
Olocation not on record	24
Berlin, DE	19
GZUlocation not on record	17
ASUlocation not on record	15
Madison, US	12
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	11
Vancouver, CA	11
TSBlocation not on record	11
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	9
Museo Achille Folettolocation not on record	9
SLU Artdatabankenlocation not on record	6
Helsinki, FI	4
Bronx, US	3
BDBClocation not on record	3
Hobart, AU	3
Museo Entomologico de Leonlocation not on record	3
Chicago, US	3
Kew, GB	3
University of Gdansklocation not on record	3
DOI/NPS, Colonial National Historical Parklocation not on record	3
MeiseBGlocation not on record	2
Durham, US	2
CLUlocation not on record	2
Entomological Society of Latvialocation not on record	2
Staatsarchiv Urilocation not on record	2
Christchurch, NZ	1
Wellington, NZ	1
Pretoria, ZA	1
BClocation not on record	1
Philadelphia, US	1
US	1
Knoxville, US	1
University of Oslo, Natural History Museumlocation not on record	1
Barcelona, ES	1
Mount Annan, AU	1
València, ES	1
San Luis Obispo, US	1
South Kensington, GB	1
McWane Science Centerlocation not on record	1

42 institutions · 453 of 457 vouchered records shown · 4 without an institution code

09Environmental DNA3 detections

Where the DNA of Rhizocarpon viridiatrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Rock outcrop

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.4 °C 23.4–23.4

Seasonal swing summer↔winter17.1 °C

Max temp (day)28.0 °C

Min temp (night)17.8 °C

Precipitation39.1 mm/mo

Air humidity55.6 %

Moisture balance-127 mm/mo

Vapour deficit1,271 Pa

Wind speed1.60 m/s

Cloud cover33.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)