Rhizocarpon superficiale

(Schaer.) Malme · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Rhizocarpales/Rhizocarpaceae/Rhizocarpon

At a glance

Occurrence records174

Data sources8

Biological traits0

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Rhizocarpon superficiale's data was compiled from.

GBIFGlobal Biodiversity Information Facility150 records↗

OBISOcean Biodiversity Information System24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF · OBIS174 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhizocarpon superficiale has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences10

eDNA detections4

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMT108258.1 ↗473 bpChina

ACGT

AAGGATCATTACCGGGACACTGCTGCCCCGGACCCCAACCCGTGTCTACACATTCGTTGCTTTGGCGGGCTGGTGCTCGGGCTAGCCCGG …

Rhizocarpon superficiale voucher 20132064 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type174 records

Wild obs. + sensor30

Museum / vouchered144

Range

Area of Occupancy AOO476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 5≤1 km 3≤10 km 4

12 georeferenced · 18 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 3≤1 km 9≤10 km 3>10 km 4

19 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence144

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	54
University of Stellenboschlocation not on record	13
Uppsala, SE	6
Pretoria, ZA	6
Edmonton, CA	5
British Antarctic Surveylocation not on record	5
Bronx, US	5
St. Paul, US	4
Berlin, DE	3
TSBlocation not on record	3
Museo Achille Folettolocation not on record	2
MeiseBGlocation not on record	2
Vancouver, CA	2
Philadelphia, US	2
UnBlocation not on record	2
Göteborg, SE	2
M-Lichenslocation not on record	2
SIBA_UMAGlocation not on record	2
Helsinki, FI	2
AASlocation not on record	1
University of Gdansklocation not on record	1
Australian Antarctic Divisionlocation not on record	1
National Biodiversity Institute, Costa Ricalocation not on record	1
San Sebastián, ES	1
GZUlocation not on record	1
Wellington, NZ	1
AADClocation not on record	1
McWane Science Centerlocation not on record	1
Chicago, US	1
Auckland, NZ	1

30 institutions · 133 of 144 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Rhizocarpon superficiale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-8.20 °C -8.20–-8.20

Seasonal swing summer↔winter25.7 °C

Max temp (day)-4.40 °C

Min temp (night)-12.2 °C

Precipitation114 mm/mo

Air humidity63.8 %

Moisture balance57.8 mm/mo

Vapour deficit152 Pa

Wind speed10.1 m/s

Cloud cover40.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)