Rhizocarpon alpicola

(Fr.) Rabenh. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Rhizocarpales/Rhizocarpaceae/Rhizocarpon

At a glance

Occurrence records1 008

Data sources9

Biological traits1

DNA specimens8

eDNA detections4

Sources9 archives

Databases and archives Rhizocarpon alpicola's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 008 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Chemical compositionNPASS5 compounds

Occurrence & distributionGBIF1 008 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Wzorzec alpejski – gatunek grzybów z rodziny wzorcowatych (Rhizocarpaceae). Ze względu na współżycie z glonami zaliczany jest do grupy porostów.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

03Chemical composition5 compounds

Compounds documented for Rhizocarpon alpicola across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Isoflavones4

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
6,7,3'-Trimethoxy-4',5'-methylenedioxyisoflavone	present	NPASS
6,7-Dimethoxy-3-(2,4,5-trimethoxyphenyl)chromen-4-one	present	NPASS
6-Hydroxy-7,2'-dimethoxy-4',5'-methylenedioxyisoflavone	present	NPASS
Milldurone	present	NPASS
QPCUKMJMYZFGRX-GFCCVEGCSA-N	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhizocarpon alpicola has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences4

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSON332060.1 ↗489 bpCanada · 2018

ACGT

ATCATTATTGAGATAGGGGGCTGATGCCCCCGAACCTCCAACCCGTGTCTACCGACCTCTTGTTGCTTTGGCGGGCCTGCGTCCGGGCTG …

Rhizocarpon alpicola voucher O L-223755 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4★ITS128SmtSSUnucLSU

fungal barcodemarker

08Occurrence & distribution

Record type1 008 records

Wild obs. + sensor350

Museum / vouchered586

Other72

Range

Area of Occupancy AOO2 628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 49≤1 km 40≤10 km 178>10 km 4

271 georeferenced · 79 without coordinates

Open the mapobservation + sensor350

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 63≤1 km 46≤10 km 108>10 km 60

277 georeferenced · 309 without coordinates

Open the institutions mapphysical evidence586

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	136
Uppsala, SE	78
Olocation not on record	62
Durham, US	49
Bergen, NO	25
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	25
DOI/NPS, Colonial National Historical Parklocation not on record	20
Madison, US	19
Polar-Alpine Botanical Garden-Institutelocation not on record	15
Berlin, DE	11
GZUlocation not on record	10
Mlocation not on record	7
Trondheim, NO	7
Entomological Society of Latvialocation not on record	6
MNHWlocation not on record	5
Staatsarchiv Urilocation not on record	5
Salzburg, AT	5
SLU Artdatabankenlocation not on record	5
Helsinki, FI	5
Edmonton, CA	4
TROMlocation not on record	4
ASUlocation not on record	4
BClocation not on record	4
Chicago, US	4
University of Gdansklocation not on record	3
WTUlocation not on record	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Oskarshamn, SE	3
PHlocation not on record	3
Institute of the Industrial Ecology Problems of the North of Kola Science Center of the Russian Academy of Sciences.location not on record	2
DClocation not on record	2
Museo Achille Folettolocation not on record	2
Oulu, FI	1
Göteborg, SE	1
BioFokuslocation not on record	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
Turku, FI	1
Metsähallituslocation not on record	1
Stockholm, SE	1
Bronx, US	1
Klostermuseum Disentislocation not on record	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
US	1

43 institutions · 547 of 586 vouchered records shown · 38 without an institution code

09Environmental DNA4 detections

Where the DNA of Rhizocarpon alpicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median1.90 °C 1.90–1.90

Seasonal swing summer↔winter22.2 °C

Max temp (day)5.80 °C

Min temp (night)-2.40 °C

Precipitation69.5 mm/mo

Air humidity63.3 %

Moisture balance17.3 mm/mo

Vapour deficit317 Pa

Wind speed1.40 m/s

Cloud cover49.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Rhizocarpon alpicola

At a glance

Sources9 archives

Habitat & environment1

Compound class profile1 class

Documented compounds5 total

At a glance

Record type1 008 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 43 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 008 records