Rhinolithodes wosnessenskii

Brandt, 1848 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Lithodidae/Rhinolithodes

At a glance

Occurrence records277

Data sources8

Biological traits2

DNA specimens7

eDNA detections5

Sources8 archives

Databases and archives Rhinolithodes wosnessenskii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility209 records↗

OBISOcean Biodiversity Information System68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS277 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD7 specimens

01Narrative

Rhinolithodes wosnessenskii, also called the rhinoceros crab or golf-ball crab, is a species of king crab, the only species in the genus Rhinolithodes. The species is named after Ilya Gavrilovich Voznesenski. It is found at depths of 6 - in the north-east Pacific Ocean from Kodiak, Alaska to Crescent City, California. R. wosnessenskii grows to 7 cm across the carapace, which is triangular and has a deep semicircular depression. The legs are covered in spines and long setae. It lives in crevices on rocky or gravel bottoms, and is only rarely encountered.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhinolithodes wosnessenskii has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes2

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

76Gmostly conserved

82Amostly conserved

318Tmostly conserved

TACATTATATTTTATTTTTGGAGCTTGAGCCGGAATAGTAGGAACTTCTTTGAGTTTAATTATTCGAGCTGAGCTGGGTCAACCAGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phyllolithodes papillosussame family8.1%Paralithodes platypussame family8.2%Lithodes turkayisame family8.6%Lithodes majasame family8.7%Lithodes aequispinussame family8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P28S

animal barcodemarker

08Occurrence & distribution

Record type277 records

Wild obs. + sensor208

Museum / vouchered65

Other4

Range

Area of Occupancy AOO452 km²

Depth

0–200 m sunlit13

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 85 m · max 201 m · 14 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 40≤1 km 144≤10 km 12>10 km 4

200 georeferenced · 8 without coordinates

Open the mapobservation + sensor208

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence65

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Victoria, CA	14
CASlocation not on record	9
Washington, US	9
Edmonton, CA	9
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3

6 institutions · 48 of 65 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Rhinolithodes wosnessenskii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

Nereocystis luetkeana forest, boulder slope,…rocky reef

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.50 °C 8.80–10.2

Seasonal swing summer↔winter13.5 °C

Max temp (day)13.9 °C 10.7–14.6

Min temp (night)6.00 °C 5.70–7.60

Precipitation176 mm/mo 129–391

Air humidity64.1 % 63.7–71.9

Moisture balance73.6 mm/mo 50.0–324

Vapour deficit430 Pa 325–445

Wind speed3.90 m/s 3.80–4.50

Cloud cover54.9 % 42.0–60.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)