Rhinogobius duospilus

(Herre, 1935) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Gobiidae/Rhinogobius

At a glance

Occurrence records435

Data sources10

Biological traits6

DNA specimens11

eDNA detections11

Sources10 archives

Databases and archives Rhinogobius duospilus's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility421 records↗

OBISOcean Biodiversity Information System14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS435 records

Environmental DNA1 datasets · 0 countries11 detections

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT · NCBI≈1 Gbp

01Narrative

Rhinogobius duospilus is a species of goby native to China and Vietnam where they can be found in fresh or brackish waters. This species can reach a length of 4.5 cm TL. In their natural environment these fish consume larvae or other similar creatures, but they can be fed brine shrimp or blood worms.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length6.2 cm

Body mass6.4 g

Habitat & environment3

Habitat brackishyes

Habitat freshwateryes

Habitat zonedemersal

Other traits1

Vulnerability10

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhinogobius duospilus has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 460 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 68 variable positions, in barcode order

48Gmostly conserved

90Cmostly conserved

126Tmostly conserved

135Amostly conserved

165Tmostly conserved

201Cmostly conserved

214Amostly conserved

258Amostly conserved

282Gmostly conserved

288Tmostly conserved

304Tmostly conserved

330Gmostly conserved

345Gmostly conserved

351Cmostly conserved

354Tmostly conserved

400Cmostly conserved

411Tmostly conserved

462Tvariable

468Tmostly conserved

486Tmostly conserved

498Gmostly conserved

510Gmostly conserved

532Cmostly conserved

546Gmostly conserved

549Cmostly conserved

558Tmostly conserved

582Tmostly conserved

591Amostly conserved

597Tmostly conserved

600Amostly conserved

612Gmostly conserved

696Tmostly conserved

699Tmostly conserved

714Cmostly conserved

774Gmostly conserved

783Tmostly conserved

798Amostly conserved

801Gmostly conserved

843Amostly conserved

891Tmostly conserved

912Amostly conserved

915Amostly conserved

939Tmostly conserved

958Amostly conserved

993Gmostly conserved

1011Cvariable

1014Tmostly conserved

1017Gmostly conserved

1026Tmostly conserved

1029Gmostly conserved

1032Gmostly conserved

1038Gmostly conserved

1047Tmostly conserved

1113Gmostly conserved

1125Amostly conserved

1158Cmostly conserved

1164Gvariable

1201Amostly conserved

1203Cmostly conserved

1212Cvariable

1224Gmostly conserved

1260Gmostly conserved

1290Amostly conserved

1353Tmostly conserved

1395Tmostly conserved

1413Gmostly conserved

1428Tmostly conserved

1432Gmostly conserved

CATAAAGACATTGGCACCCTTTATCTTGTATTTGGTGCCTGAGCTGGGATAGTGGGCACGGCCTTGAGCCTCCTTATTCGAGCCGAGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes4

BIN1

Most divergent pair4.5%

Other

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Rhinogobius duospilus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 031 614 774 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Rhinogobius duospilus1.03 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type435 records

Wild obs. + sensor423

Museum / vouchered12

Range

Area of Occupancy AOO744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 80≤1 km 45≤10 km 142>10 km 130

397 georeferenced · 26 without coordinates

Open the mapobservation + sensor423

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Nebraskalocation not on record	4

1 institutions · 4 of 12 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Rhinogobius duospilus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)