Rhinocladiella mackenziei

(C.K.Campb. & Al-Hedaithy) Arzanlou & Crous · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Chaetothyriales/Herpotrichiellaceae/Rhinocladiella

At a glance

Occurrence records8

Data sources8

Biological traits0

DNA specimens20

eDNA detections11

Sources8 archives

Databases and archives Rhinocladiella mackenziei's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF8 records

Environmental DNA2 datasets · 5 countries11 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceGoaT · NCBI≈33 Mbp

01Narrative

Rhinocladiella mackenziei is a deeply pigmented fungus that is a common cause of human cerebral phaeohyphomycosis. Rhinocladiella mackenziei was believed to be endemic solely to the Middle East, due to the first cases of infection being limited to the region. However, cases of R. mackenziei infection are increasingly reported from regions outside the Middle East. This pathogen is unique in that the majority of cases have been reported from immunologically normal people.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhinocladiella mackenziei has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes4

GenBank sequences10

eDNA detections11

Countries7

The DNA barcodea real sequence read deposited for this species

ITSMZ128137.1 ↗391 bp

ACGT

ACAAAAAAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAAT …

Rhinocladiella mackenziei strain CNRMA18.545 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS25-8S

fungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Rhinocladiella mackenziei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈32 602 137 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Rhinocladiella mackenziei0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type8 records

Museum / vouchered8

Range

Area of Occupancy AOO32 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

10Collections & institutions

Institution	Specimens
Institut Pasteur, Parislocation not on record	1

1 institutions · 1 of 8 vouchered records shown · 4 without an institution code

09Environmental DNA11 detections

Where the DNA of Rhinocladiella mackenziei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys2

Countries5

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 10.9–26.8

Seasonal swing summer↔winter17.1 °C

Max temp (day)22.4 °C 14.6–33.0

Min temp (night)11.4 °C 6.40–19.6

Precipitation45.3 mm/mo 8.70–83.9

Air humidity51.8 % 42.6–62.3

Moisture balance-83.2 mm/mo -174–6.70

Vapour deficit1,017 Pa 546–2,164

Wind speed3.60 m/s 2.80–4.70

Cloud cover24.0 % 12.3–44.0

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)