Rhinemys rufipes

(Spix, 1824) · species

image placeholder — illustration coming later

Animalia/Chordata/Testudines/Chelidae/Rhinemys

At a glance

Occurrence records16

Data sources10

Biological traits1

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Rhinemys rufipes's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF16 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD3 specimens

Genome at a glanceGoaT2n = 58

01Narrative

The red side-necked turtle (Rhinemys rufipes), red turtle, red-footed sideneck turtle, William's toadhead turtle, or red-footed Amazon side-necked turtleRhinemys rufipes , The Reptile Database is a monotypic species of turtle in the family Chelidae. It is found in Colombia and possibly Peru and Brazil. This species is dimorphic in size meaning the sexes show different characteristics. One study found that the largest female out of a group of 24 was 256 mm in carapace length. Out of that same group, the largest male was only 199 mm in carapace length.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDB

Life cycle & reproduction1

Litter size7.5

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhinemys rufipes has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CCTCTACCTAATCTTCGGCGCCTGAGCAGGAATAATTGGCACAGCCCTCAGCCTACTAATTCGAACAGAACTAAGCCAACCTGGCCCACT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mesoclemmys vanderhaegeisame family9.5%Mesoclemmys ranicepssame family11.2%Acanthochelys radiolatasame family11.5%Phrynops geoffroanussame family11.7%Acanthochelys macrocephalasame family12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Rhinemys rufipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 58 n = 29

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 581×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type16 records

Wild obs. + sensor8

Museum / vouchered8

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 6

6 georeferenced · 2 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	3
Universidad Nacional de Colombia (UNAL)location not on record	2
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	2
Instituto Amazónico de Investigaciones Científicas SINCHI Colección Reptileslocation not on record	1

4 institutions · 8 of 8 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Rhinemys rufipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)