Rhaphidophora decursiva

(Roxb.) Schott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Rhaphidophora

At a glance

Occurrence records383

Data sources10

Biological traits13

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Rhaphidophora decursiva's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility383 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS · NPASS34 compounds

Occurrence & distributionGBIF383 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 54

01Narrative

Rhaphidophora decursivaSchott HW (1857) Bonplandia (Hannover) 5: 45. is a species of flowering plant in the family Araceae. It is native to China, the Indian Subcontinent, and Indochina.Kew World Checklist of Selected Plant FamiliesFlora of China Vol. 23 Page 14, 爬树龙 pa shu long, Rhaphidophora decursiva (Roxburgh) Schott, Bonplandia (Hannover). 5: 45. 1857.Ara, H. (2001). An Annotated Checklist of Aroids of Bangladesh. Bangladesh Journal of Plant Taxonomy 8(2): 19-34.Govaerts, R. & Frodin, D.G. (2002). World Checklist and Bibliography of Araceae (and Acoraceae): 1-560. The Board of Trustees of the Royal Botanic Gardens, Kew.Pandey, R.P. & Dilwakar, P.G. (2008). An integrated check-list flora of Andaman and Nicobar islands, India. Journal of Economic and Taxonomic Botany 32: 403-500.Wu, Z. & Raven, P.H. (eds.) (2010). Flora of China 23: 1-515. Missouri Botanical Garden Press, St. Louis.Boyce, P.C., Sookchaloem, D., Hetterscheid, W.L.A., Gusman, G., Jacobsen, N., Idei, T. & Nguyen, V.D. (2012). Flora of Thailand 11(2): 101-325. The Forest Herbarium, National Park, Wildlife and Plant Conservation Department, Bangkok.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Deciduousnessevergreen

Life formclimber

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Elevation max2 200 m

Elevation min600 m

Epiphyteterrestrial

Growth formherb

Mycorrhiza type0.000261265

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition34 compounds

Compounds documented for Rhaphidophora decursiva across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Neolignans8

Furanoid lignans6

Illudalane sesquiterpenoids4

Furofuranoid lignans4

Zearalenones2

Documented compounds34 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Dehydrovomifoliol	present	LOTUS
(-)-Pinoresinol	present	LOTUS
(-)-Syringaresinol	present	LOTUS
(2R)-2-(2,6-dimethoxy-4-prop-2-enylphenoxy)-3-(3,4,5-trimethoxyphenyl)propan-1-ol	present	LOTUS
(2R,3R,4R,5R)-3,4-Dimethyl-2,5-bis(3,4,5-trimethoxyphenyl)tetrahydrofuran	present	LOTUS
(2R,3R,4S,5R)-3,4-dimethyl-2,5-bis(3,4,5-trimethoxyphenyl)oxolane	present	LOTUS
(2S,3R,4R,5R)-3,4-dimethyl-2,5-bis(3,4,5-trimethoxyphenyl)tetrahydrofuran	present	LOTUS
(5R,11E)-15-hydroxy-17-methoxy-5-methyl-3,4-dioxabicyclo[11.4.0]heptadeca-1(13),11,14,16-tetraen-2-one	present	LOTUS
(7R,8R)-Polysphorin	present	LOTUS
(s)-5-Hydroxy-3,4-dimethyl-5-pentylfuran-2(5h)-one	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhaphidophora decursiva has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLMK206666.1 ↗1 374 bp

ACGT

GATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTT …

Rhaphidophora decursiva voucher Chase M 8601 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Rhaphidophora decursiva carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidypolyploid inferred

Chromosome records26–562n range54median54mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 543×CCDB · book-indian_vol2 · CCDB · book-fedorov · CCDB · Cave1956supp

CCDB · book-indian_vol2 — Mookerjea, A. 1955a

CCDB · book-fedorov — Mookerjea 1955a

CCDB · Cave1956supp — Mookerjea 1955b

2n 262×CCDB · ipcn-api-dl · CCDB · book-indian_vol2

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA & U. Chatterjee. 1978a. In IOPB chromosome number reports LXII. Taxon 27: 519–535.

CCDB · book-indian_vol2 — Sarkar, A.K., Datta, N. & Chatterjee, u. 1978

2n 561×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — CHAUDHURI, J. B. & A. Sharma. 1979. Chromosome studies in certain members of Araceae. Genét. Ibér. 30–31: 161–188.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.661 ↗

08Occurrence & distribution

Record type383 records

Wild obs. + sensor143

Museum / vouchered222

Cultivated / captive2

Other16

Range

Area of Occupancy AOO880 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 54≤1 km 22≤10 km 6>10 km 5

87 georeferenced · 56 without coordinates

Open the mapobservation + sensor143

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 220 without coordinates

Open the institutions mapphysical evidence222

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	46
Kunming, CN	39
Guilin, CN	23
CASlocation not on record	23
Kew, GB	19
Guangzhou, CN	12
Edinburgh, GB	11
Southwest Forestry Collegelocation not on record	5
Bronx, US	3
Saint Louis, US	3
Yangling, CN	3
South Kensington, GB	3
Guiyang, CN	3
Yunnan Universitylocation not on record	3
JBRJlocation not on record	2
Chengdu, CN	2
Guangzhou, CN	1
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	1
Xiamen, CN	1
Cambridge, US	1
Stockholm, SE	1
Miami, US	1
Servico de Microbiologia e Imunologialocation not on record	1
Taipei, TW	1
Herbarium of the Department of Botany, University of Tokyolocation not on record	1
Henry Brockhouse Collectionlocation not on record	1
Guangxi Medicinal Botanic Gardenlocation not on record	1
Changsha, CN	1
Lake Charles, US	1
Guizhou Forestry Schoollocation not on record	1
University of Stellenboschlocation not on record	1

31 institutions · 215 of 222 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)