Rhamphospora nymphaeae

D.D.Cunn. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Exobasidiomycetes/Doassansiales/Rhamphosporaceae/Rhamphospora

At a glance

Occurrence records118

Data sources7

Biological traits0

DNA specimens1

eDNA detections5

Sources7 archives

Databases and archives Rhamphospora nymphaeae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility118 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF118 records

Environmental DNA5 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

钩孢黑粉菌科为实球黑粉菌目的一个科。

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhamphospora nymphaeae has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ831034.1 ↗593 bp

ACGT

GTGAATGAACCGGGGTCCTCGCTCTGCGAGCTCCCCTTCTCCACTACATACACACCTGTGAACCGTTGTGGTCGTGTGTGTCGCAAGATG …

Rhamphospora nymphaeae AFTOL-ID 1645 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type118 records

Wild obs. + sensor39

Museum / vouchered75

Other4

Range

Area of Occupancy AOO340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 15≤10 km 18>10 km 2

35 georeferenced · 4 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 2>10 km 3

5 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence75

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Görlitz, DE	9
DPIlocation not on record	9
MeiseBGlocation not on record	8
Kew, GB	7
Auckland, NZ	6
Karlsruhe, DE	6
CA	5
Bernard Price Institute for Palaeontological Researchlocation not on record	3
Berlin, DE	2
Mlocation not on record	1
McWane Science Centerlocation not on record	1
Champaign, US	1

12 institutions · 58 of 75 vouchered records shown · 17 without an institution code

09Environmental DNA5 detections

Where the DNA of Rhamphospora nymphaeae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys5

Countries1

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 18.4–18.4

Seasonal swing summer↔winter19.8 °C

Max temp (day)21.5 °C

Min temp (night)14.1 °C

Precipitation187 mm/mo

Air humidity59.4 %

Moisture balance104 mm/mo

Vapour deficit854 Pa

Wind speed1.00 m/s

Cloud cover44.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)