Rhamphomyia crassirostris

(Fallén, 1816) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Empididae/Rhamphomyia

At a glance

Occurrence records2 172

Data sources7

Biological traits2

DNA specimens204

eDNA detections1 020

Sources7 archives

Databases and archives Rhamphomyia crassirostris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 172 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 020 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics204 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 172 records

Environmental DNA4 datasets · 9 countries1 020 detections

DNA & barcodingBOLD204 specimens

01Narrative

Rhamphomyia crassirostris is a species of dance flies, in the fly family Empididae. It is found in most of Europe, east to Poland and Hungary. It is absent from Italy and the Balkan Peninsula.Fauna EuropaeaBei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Parts I, II. Amerind Publishing Co., New Delhi.Collin, J.E. (1961) British Flies. VI. Empididae. Cambridge: Cambridge University Press. Rhamphomyia crassirostris, Llwiniarth, North Wales, May 2013 (16285332253).jpg |''Rhamphomyia crassirostris'' specimen North Wales

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding204 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhamphomyia crassirostris has left across the world's sequence archives.

At a glance

DNA specimens204

BINs1

Marker genes1

eDNA detections1 020

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus203 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

98Gmostly conserved

124Tmostly conserved

130Amostly conserved

202Amostly conserved

209Cmostly conserved

238Amostly conserved

244Tmostly conserved

271Tmostly conserved

310Tmostly conserved

358Cmostly conserved

511Cvariable

526Cmostly conserved

547Amostly conserved

613Tmostly conserved

ATTATACTTTATTTTTGGGGCTTGAGCAGGAATGGTAGGAACTTCTTTAAGAATCCTAATTCGAATAGAATTAGGACACCCAGGGGCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes25

BIN1

Most divergent pair2.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Empis stercoreasame family11.2%Empis univittatasame family12.2%Empis nigricanssame family12.2%Hilara quadrifasciatasame family12.5%Rhamphomyia albitarsissame genus12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 172 records

Wild obs. + sensor1 053

Museum / vouchered1 119

Range

Area of Occupancy AOO3 884 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 593≤1 km 274≤10 km 174>10 km 2

1 043 georeferenced · 10 without coordinates

Open the mapobservation + sensor1 053

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 944≤1 km 100≤10 km 51

1 095 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence1 119

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	87
NCMGlocation not on record	46
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	45
CBDClocation not on record	17
MZLUlocation not on record	17
NTNU-VMlocation not on record	15
University of Tokyo, Department of Zoologylocation not on record	13
BioFokuslocation not on record	7
Tromsø, NO	7
Tilburg, NL	6
Gothenburg, SE	5
Helsinki, FI	5
Stockholm, SE	4
Metsähallituslocation not on record	4
South Kensington, GB	2
ZMAAlocation not on record	2
Paris, FR	1
Rovaniemi, FI	1
NHMOlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1

21 institutions · 287 of 1 119 vouchered records shown · 832 without an institution code

09Environmental DNA1 020 detections

Where the DNA of Rhamphomyia crassirostris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 020

Studies independent surveys4

Countries9

Verifiable raw sequence linked380

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 020 detections have coordinates

Open the map9 countries0

Garden and heatland, coastal habitatcadaver landfillFarmland, coast and birch habitatGarden, coast and birch habitatFarmenvironment, farmland, coast and birch h…Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 10.2–14.6

Seasonal swing summer↔winter15.4 °C

Max temp (day)15.1 °C 11.4–18.4

Min temp (night)8.20 °C 6.40–11.0

Precipitation81.3 mm/mo 58.0–109

Air humidity61.1 % 58.0–65.4

Moisture balance-27.0 mm/mo -56.2–4.10

Vapour deficit532 Pa 440–675

Wind speed4.30 m/s 2.50–5.50

Cloud cover50.5 % 41.0–61.6

CHELSA 1981–2010, ~9 km grid, at location & month of 1 012 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Rhamphomyia crassirostris

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type2 172 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 172 records