Rhamnus lycioides

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Rhamnus

At a glance

Occurrence records18 958

Data sources11

Biological traits33

DNA specimens3

eDNA detections5

Sources11 archives

Databases and archives Rhamnus lycioides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 958 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources33 traits

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF18 958 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Rhamnus lycioides, l' Aubépine noire, l' Argousier européen ou encore l' Argousier de la Méditerranée, est une espèce de plantes à fleurs de la famille des Rhamnaceae. C’est un arbuste atteignant environ 1 mètre de haut. On le trouve dans la région méditerranéenne dans le sud de l'Europe et en Afrique du Nord. Son nom scientifique lycioides fait référence à sa ressemblance avec le genre botanique Lycium.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology11

Fruit length5.7 mm

Fruit width6.1 mm

Leaf size72.43 mm²

Plant height0.752 m

Plant height generative0.753 m

Seed mass13.82 mg

⚠ sources differ — TRY: 13.82 mg · GIFT: 18.95 mg

Seed mass max25.89 mg

Seed mass min25.89 mg

Seed volume14 mm³

Seed volume max14 mm³

Seed volume min14 mm³

Life cycle & reproduction6

DeciduousnessDeciduous

Dehiscenceindehiscent

Dispersal typeanimal

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio24.7 g/g

Leaf c457 mg/g

Leaf dry-matter content (LDMC)346 mg/g

Leaf n20.13 mg/g

Leaf p2.52 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)10.37 mm²/mg

Wood density143 mg/cm³

03Chemical composition10 compounds

Compounds documented for Rhamnus lycioides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavonols6

Dihydroflavonols2

Flavan-3-ols1

Flavanones1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Eriodictyol	present	LOTUS
(+)-taxifolin	present	LOTUS
alpha-Catechin	present	LOTUS
Aromadendrin	present	LOTUS
Isorhamnetin	present	LOTUS
Kaempferol	present	LOTUS
Quercetin	present	LOTUS
Quercetin 3-O-methyl-ether	present	LOTUS
Rhamnazin	present	LOTUS
Rhamnocitrin	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhamnus lycioides has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences8

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY626437.1 ↗630 bp

ACGT

GATCATTGTCGATACCCTGCACAGCAGAACGACCCGTGAACTAGTAAATCCAACTCGGGAGCGAGGGGCCCTAGAGCCCCGGACCTCCTT …

Rhamnus lycioides internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS7

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Rhamnus lycioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · mediterranean · CCDB · CromoCat 2015

CCDB · mediterranean

CCDB · CromoCat 2015 — Oberprieler, C. & R. Vogt. (1994). Reports (294-312). Fl. Medit. 4: 262-269.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type18 958 records

Wild obs. + sensor18 608

Museum / vouchered252

Other98

Origin

Native2 658

Range

Area of Occupancy AOO33 704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 7 932≤1 km 2 935≤10 km 1 691>10 km 17

12 575 georeferenced · 6 033 without coordinates

Open the mapobservation + sensor18 608

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 9≤1 km 85≤10 km 33

127 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence252

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College of the Atlantic, Museumlocation not on record	20
MAlocation not on record	20
Phyletisches Museum Jenalocation not on record	19
BClocation not on record	18
Museo della Bonifica di San Donà di Piavelocation not on record	15
Granada, ES	13
Barcelona, ES	12
CICYTEXlocation not on record	12
BDBClocation not on record	11
UIBlocation not on record	9
Wlocation not on record	9
Rishon Le Zion, IL	8
Madrid, ES	7
Alicante, ES	7
Madrid, ES	5
Museo Achille Folettolocation not on record	5
Paris, FR	4
Vitoria, ES	4
Salamanca, ES	4
Pamplona, ES	3
Badajoz, ES	3
JBSlocation not on record	3
ESP003location not on record	2
Sevilla, ES	2
Entomological Society of Latvialocation not on record	2
València, ES	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
LDlocation not on record	2
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Jaén, ES	1
JBCLMlocation not on record	1
Moscow State Universitylocation not on record	1
Henry Brockhouse Collectionlocation not on record	1
Uniwersytet Jagiellońskilocation not on record	1
Sevilla, ES	1
Gijón, ES	1
Córdoba, ES	1

37 institutions · 232 of 252 vouchered records shown · 19 without an institution code

09Environmental DNA5 detections

Where the DNA of Rhamnus lycioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C

Min temp (night)9.00 °C

Precipitation33.4 mm/mo

Air humidity52.9 %

Moisture balance-61.7 mm/mo

Vapour deficit953 Pa

Wind speed2.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Rhamnus lycioides

At a glance

Sources11 archives

Size & morphology11

Life cycle & reproduction6

Diet & foraging1

Habitat & environment7

Physiology & chemistry8

Compound class profile4 classes

Documented compounds10 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type18 958 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type18 958 records