Rhamnus integrifolia

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Rhamnus

At a glance

Occurrence records94

Data sources6

Biological traits22

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Rhamnus integrifolia's data was compiled from.

GBIFGlobal Biodiversity Information Facility94 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources22 traits

Occurrence & distributionGBIF94 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPGIFT

Size & morphology9

Fruit length max7 mm

Fruit length min5 mm

Fruit width max7 mm

Fruit width min7 mm

Leaf length max100 mm

Leaf length min80 mm

Leaf width max30 mm

Leaf width min25 mm

Plant height max1.2 m

Life cycle & reproduction6

Flower colourgreen

Flower width max5 mm

Flowering endJun

Flowering startApr

Life formsubshrub or shrub

Life spanperennial

Habitat & environment7

Climatetemperate

Elevation max2 000 m

Elevation min400 m

Fruit colourblack

Growth formshrub

Leaf formelliptic

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhamnus integrifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ188985.1 ↗632 bpSpain

ACGT

GTCAAAACCCTGCACAGCAGAACGACCCGGAACTCGTAAAACCAACTCGGGGGCGAGGGGCCCCAGGCCCCAGACCTCCTTGGCATGGGG …

Rhamnus integrifolia isolate SMNS_159 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type94 records

Wild obs. + sensor71

Museum / vouchered23

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy3% within 1 km

≤100 m 1≤1 km 1≤10 km 45>10 km 23

70 georeferenced · 1 without coordinates

Open the mapobservation + sensor71

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1>10 km 1

2 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Moscow State Universitylocation not on record	21
GJOlocation not on record	1
LDlocation not on record	1

3 institutions · 23 of 23 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Rhamnus integrifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)