Rhabdocline pseudotsugae

Syd. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Cenangiaceae/Rhabdocline

At a glance

Occurrence records283

Data sources7

Biological traits0

DNA specimens0

eDNA detections1

Sources7 archives

Databases and archives Rhabdocline pseudotsugae's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility283 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF283 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Rhabdocline pseudotsugae is a fungal plant pathogen. The pathogen, along with Rhabdocline weirii causes Rhabdocline needlecast; R. weirii only affects Douglas-fir trees. The disease causes the needles of the tree to discolor and eventually fall from the tree. It was originally common to the Rocky Mountain states of the United States but has since spread to Europe. Infections usually start in the spring or early summer and can change the color of the foliage to a variety of hues. The fungus produces apothecia that are normally found on the underside of needles but they also occur on the topside as well.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rhabdocline pseudotsugae has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences7

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSU92290.1 ↗459 bp

ACGT

CATTACCGAGTTTCTTGCCCTAGCGGGCAGATCTCCCACCCGTGTGTATTTATACCGTGTTGCTTTGGCGCCTCCAGGCCTCACCGCCCG …

Rhabdocline pseudotsugae subsp. pseudotsugae isolate 2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type283 records

Wild obs. + sensor38

Museum / vouchered241

Other4

Range

Area of Occupancy AOO616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy18% within 1 km

≤100 m 1≤1 km 6≤10 km 6>10 km 25

38 georeferenced

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 1≤1 km 49≤10 km 126>10 km 17

193 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence241

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	94
Helsinki, FI	28
Olocation not on record	27
Catholic University of Pekinglocation not on record	22
Pullman, US	19
Madison, US	13
Zürich, CH	4
FLASlocation not on record	4
TENN-Flocation not on record	3
Chicago, US	3
DPIlocation not on record	3
Tartu, EE	2
Bronx, US	2
Uppsala, SE	2
Karlsruhe, DE	2
Durham, US	1
Chapel Hill, US	1
Mlocation not on record	1
WTUlocation not on record	1
Brown Universitylocation not on record	1
Baton Rouge, US	1
Laramie, US	1
LDlocation not on record	1

23 institutions · 236 of 241 vouchered records shown · 5 without an institution code

09Environmental DNA1 detections

Where the DNA of Rhabdocline pseudotsugae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)