Retiboletus ornatipes

(Peck) Manfr.Binder & Bresinsky · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Retiboletus

At a glance

Occurrence records2 941

Data sources9

Biological traits0

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Retiboletus ornatipes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 941 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS36 compounds

Occurrence & distributionGBIF2 941 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI40 Mbp

01Narrative

Retiboletus ornatipes, commonly known as the ornate-stalked bolete or goldstalk, is a species of bolete fungus in the family Boletaceae. Originally named Boletus ornatipes by American mycologist Charles Horton Peck in 1878, it was transferred to Retiboletus in 2002. One guide lists the species as inedible, while another says it is choice.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition36 compounds

Compounds documented for Retiboletus ornatipes across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Neolignans5

Flavones4

Neolignans $ Pulvinones3

Pulvinones2

Ursane and Taraxastane triterpenoids2

Documented compounds36 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,4S,5S,9S,10R,12S,13R)-13-hydroxy-5,9,13-trimethyltetracyclo[10.2.2.01,10.04,9]hexadecane-5-carboxylic acid	present	NPASS
(1S,4S,5S,9S,10R,12S,13S)-13-hydroxy-5,9,13-trimethyltetracyclo[10.2.2.01,10.04,9]hexadecane-5-carboxylic acid	present	NPASS
(1S,4S,6R,9S,10R,12R,13R,14S)-5,5,9,13-tetramethylpentacyclo[11.2.1.01,10.04,9.012,14]hexadecan-6-ol	present	NPASS
(3R,8S)-3',8,16'-trihydroxyspiro[4,7-dioxatricyclo[7.3.0.02,6]dodeca-1(9),2(6)-diene-3,11'-9-oxatricyclo[11.3.1.12,6]octadeca-1(16),2,4,6(18),13(17),14-hexaene]-5,10,10'-trione	present	LOTUS
(8'R,12R)-4-hydroxy-8'-methoxyspiro[2,10-dioxatricyclo[12.2.2.13,7]nonadeca-1(16),3,5,7(19),14,17-hexaene-12,3'-4,7-dioxatricyclo[7.3.0.02,6]dodeca-1(9),2(6)-diene]-5',10',11-trione	present	LOTUS
(8'S,12R)-4,5,8'-trihydroxyspiro[2,10-dioxatricyclo[12.2.2.13,7]nonadeca-1(16),3(19),4,6,14,17-hexaene-12,3'-4,7-dioxatricyclo[7.3.0.02,6]dodeca-1(9),2(6)-diene]-5',10',11-trione	present	LOTUS
(8'S,12R)-4,8'-dihydroxyspiro[2,10-dioxatricyclo[12.2.2.13,7]nonadeca-1(16),3,5,7(19),14,17-hexaene-12,3'-4,7-dioxatricyclo[7.3.0.02,6]dodeca-1(9),2(6)-diene]-5',10',11-trione	present	LOTUS
(alphaE)-alpha-(4-(3,4-Dihydroxyphenyl)-3-hydroxy-5-oxo-2(5H)-furanylidene)-4-hydroxybenzeneacetic acid	present	LOTUS
2-(4-hydroxyphenyl)ethyl (2S)-4-hydroxy-3-(4-hydroxyphenyl)-2-[(4-hydroxyphenyl)methyl]-5-oxofuran-2-carboxylate	present	LOTUS
2-[4-(3,4-Dihydroxyphenyl)-3-hydroxy-5-oxofuran-2-ylidene]-2-(4-hydroxyphenyl)acetic acid	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Retiboletus ornatipes has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKY825964.1 ↗420 bpCanada · 1988

ACGT

TTTTGAAGATGGTCGCTGGCCTTTTAGGCATGTGCACGTCGGATCAATACACACACCTGTGCACCTATTGTAGGTTCTCGGAAGAGGATC …

Retiboletus ornatipes voucher CMMF000107 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Retiboletus ornatipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size40 025 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Retiboletus ornatipes0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness88% BUSCO

08Occurrence & distribution

Record type2 941 records

Wild obs. + sensor2 860

Museum / vouchered81

Range

Area of Occupancy AOO7 992 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 1 238≤1 km 452≤10 km 391>10 km 252

2 333 georeferenced · 527 without coordinates

Open the mapobservation + sensor2 860

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 2≤1 km 6≤10 km 15

23 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	23
Acadia Universitylocation not on record	10
Görlitz, DE	8
TENN-Flocation not on record	6
Odawara, JP	5
Tomioka, JP	5
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	4
Bando, JP	4
Bronx, US	3
Toronto, CA	3
FLASlocation not on record	2
Durham, US	1
Ann Arbor, US	1
Chapel Hill, US	1
National Institute of Biological Resourceslocation not on record	1
Toyota city nature sanctuarylocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
Helsinki, FI	1

18 institutions · 80 of 81 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Retiboletus ornatipes

At a glance

Sources9 archives

Compound class profile5 classes

Documented compounds36 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 941 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 18 geolocated

Record type2 941 records