Resapamea passer

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Resapamea

At a glance

Occurrence records483

Data sources6

Biological traits0

DNA specimens34

eDNA detections38

Sources6 archives

Databases and archives Resapamea passer's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility483 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF483 records

Environmental DNA1 datasets · 2 countries38 detections

DNA & barcodingBOLD34 specimens

01Narrative

Resapamea passer, the dock rustic moth, is a moth in the family Noctuidae. It is found from central Alberta to northern Arizona in the Rocky Mountain region. In the mid-Continent it ranges from Minnesota and southern Ontario to Oklahoma and North Carolina, reaching the Atlantic Coast from Newfoundland to Maryland.Pacific Northwest Moths The habitat consists of wetlands. The length of the forewings is 15–19 mm. Adults are dull brown, red-brown, or yellow-brown in color. Adults are on wing from May to October in the south and from June to August in Quebec and farther north. There is one generation in the north and there are two generations in the south.Bug Guide The larvae feed on Rumex and possibly Polygonum species. They bore into the stems and roots of their host plant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Resapamea passer has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes1

eDNA detections38

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

217Gmostly conserved

352Amostly conserved

565Amostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACCTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.22%

Haplotypes10

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Resapamea mammuthussame genus2.4%Resapamea vulpeculasame genus2.6%Resapamea innotasame genus3.5%Mesapamea secalissame family4.4%Resapamea diluviussame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type483 records

Wild obs. + sensor126

Museum / vouchered357

Range

Area of Occupancy AOO964 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 71≤1 km 19≤10 km 20>10 km 1

111 georeferenced · 15 without coordinates

Open the mapobservation + sensor126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 19≤1 km 49≤10 km 111>10 km 18

197 georeferenced · 160 without coordinates

Open the institutions mapphysical evidence357

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	102
New Haven, US	64
Royal Saskatchewan Museumlocation not on record	48
University of Alberta Museums (UAM)location not on record	30
St. Paul, US	24
Vernal, US	20
Colorado State Universitylocation not on record	20
Oregon State Arthropod Collectionlocation not on record	17
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
Mississippi State, US	8
Decorah, US	3
King Saud Universitylocation not on record	3
Philadelphia, US	2
Denver, US	2
Toronto, CA	2
KWPlocation not on record	1
ASUlocation not on record	1
Cornell University Insect Collectionlocation not on record	1

18 institutions · 357 of 357 vouchered records shown

09Environmental DNA38 detections

Where the DNA of Resapamea passer was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map2 countries0

GrasslandMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 11.8–20.4

Seasonal swing summer↔winter24.5 °C

Max temp (day)20.3 °C 17.0–24.9

Min temp (night)10.6 °C 7.20–15.6

Precipitation72.0 mm/mo 15.7–107

Air humidity56.7 % 41.5–61.5

Moisture balance-61.2 mm/mo -125–-23.6

Vapour deficit733 Pa 608–1,191

Wind speed2.50 m/s 1.30–4.50

Cloud cover38.1 % 20.5–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)