Remiz pendulinus

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Remizidae/Remiz

At a glance

Occurrence records254 998

Data sources11

Biological traits29

DNA specimens17

eDNA detections16

Sources11 archives

Databases and archives Remiz pendulinus's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility254 998 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF254 998 records

Environmental DNA1 datasets · 3 countries16 detections

DNA & barcodingBOLD17 specimens

Genome at a glanceGoaT · NCBI≈1 Gbp

01Narrative

The Eurasian penduline tit or European penduline tit (Remiz pendulinus) is a passerine bird of the genus Remiz. It is relatively widespread throughout the western Palearctic. It is migratory in the northern part of its range but resident in the southern part. The breeding range in Western Europe experienced an expansion during the 1980s and 1990s. This was accompanied by an expansion of the species’ winter range and reached as far south as northern Morocco. It builds an elaborate hanging nest, formerly used in Central Europe as children's slippers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAnAgeAVONETEltonTraits

Size & morphology13

Beak depth3.9 mm

Beak length (culmen)10.6 mm

Beak length (nares)7.5 mm

Beak width3.1 mm

Body mass9.3 g

Body mass (female)8.7 g

Body mass (male)9.6 g

Hand-wing index19.4

Kipp's distance10.9 mm

Secondary length45.2 mm

Tail length48.5 mm

Tarsus length13.7 mm

Wing length56.1 mm

Life cycle & reproduction5

Age at maturity (male)365 days

Age at sexual maturity365 days

Egg mass0.95 g

Litter size3.35

Max. longevity86.4 months

Diet & foraging7

Ground33 %

Invertebrate60 %

Midhigh33 %

Seed40 %

Trophic levelomnivore

Trophic nicheInvertivore

Understory33 %

Habitat & environment4

HabitatWetland

Migration3.0

Primary lifestyleInsessorial

Range size5 985 829 km²

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Remiz pendulinus has left across the world's sequence archives.

At a glance

DNA specimens17

BINs2

Marker genes1

eDNA detections16

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P568 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)0.72%

Haplotypes2

BINs2

Most divergent pair5.6%

Where individuals differ — all 33 variable positions, in barcode order

5Amostly conserved

8Gmostly conserved

20Gmostly conserved

29Tmostly conserved

47Cmostly conserved

80Amostly conserved

83Cmostly conserved

86Amostly conserved

95Amostly conserved

101Tmostly conserved

107Gmostly conserved

119Gmostly conserved

134Cmostly conserved

164Gmostly conserved

182Cmostly conserved

194Gmostly conserved

197Gmostly conserved

203Gmostly conserved

215Cmostly conserved

221Amostly conserved

227Gmostly conserved

254Tmostly conserved

263Tmostly conserved

299Tmostly conserved

302Cmostly conserved

314Tmostly conserved

338Cmostly conserved

356Cmostly conserved

413Gmostly conserved

419Tmostly conserved

428Cmostly conserved

503Tmostly conserved

551Cmostly conserved

CCCTACTGGGAGACGACCAGATCTACAATGTGGTCGTCACAGCCCACGCCTTCGTAATAATTTTCTTCATAGTCATGCCAATCATAATCG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Parus monticolussame order10.0%Baeolophus wollweberisame order10.2%Campylorhynchus albobrunneussame order10.8%Campylorhynchus zonatussame order11.0%Ficedula albicollissame order11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Remiz pendulinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 009 155 075 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Remiz pendulinus1.01 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type254 998 records

Wild obs. + sensor254 417

Museum / vouchered502

Cultivated / captive77

Other2

Origin

Native42 008

Range

Area of Occupancy AOO89 780 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 21 232≤1 km 33 682≤10 km 41 010>10 km 4 592

100 516 georeferenced · 153 901 without coordinates

Open the mapobservation + sensor254 417

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 5≤1 km 73≤10 km 254>10 km 51

383 georeferenced · 119 without coordinates

Open the institutions mapphysical evidence502

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy95% within 1 km

≤100 m 29≤1 km 44≤10 km 4

77 georeferenced

Open the mapnot free-living77

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MNHAHlocation not on record	25
Provincia di Livornolocation not on record	21
Philadelphia, US	13
Barcelona, ES	12
Helsinki, FI	9
Seattle, US	8
Cambridge, US	8
EEZAlocation not on record	7
Geneva, CH	6
NHMOlocation not on record	5
MZLUlocation not on record	5
Philadelphia, US	4
Texas Cooperative Wildlife Collectionlocation not on record	4
Stockholm, SE	4
SNSDlocation not on record	3
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	3
Adam Mickiewicz University in Poznańlocation not on record	3
Natural History Museum, Aarhus Denmarklocation not on record	2
Institute of Plant and Animal Ecology UB RASlocation not on record	2
IMEDEAlocation not on record	2
Toronto, CA	2
Zografou, GR	2
San Diego, US	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Tallinn, EE	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
NSMKlocation not on record	1
Auckland, NZ	1
Forssa, FI	1
South Kensington, GB	1

30 institutions · 159 of 502 vouchered records shown · 343 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA16 detections

Where the DNA of Remiz pendulinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median3.40 °C 3.40–17.8

Seasonal swing summer↔winter26.2 °C

Max temp (day)8.60 °C 8.60–23.1

Min temp (night)-3.40 °C -3.40–13.0

Precipitation68.4 mm/mo 27.7–69.2

Air humidity56.8 % 51.6–60.8

Moisture balance-20.0 mm/mo

Vapour deficit409 Pa 409–986

Wind speed3.60 m/s

Cloud cover42.8 % 32.1–43.9

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Remiz pendulinus

At a glance

Sources11 archives

Size & morphology13

Life cycle & reproduction5

Diet & foraging7

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type254 998 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 30 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type254 998 records