Remiz consobrinus

(Swinhoe, 1870) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Remizidae/Remiz

At a glance

Occurrence records10 076

Data sources6

Biological traits28

DNA specimens14

eDNA detections0

Sources6 archives

Databases and archives Remiz consobrinus's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 076 records↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Occurrence & distributionGBIF10 076 records

DNA & barcodingBOLD14 specimens

01Narrative

The Chinese penduline tit (Remiz consobrinus) is a bird in the family Remizidae. The species was first described by Robert Swinhoe in 1870. It is found in China, Japan, North Korea, South Korea, and Russia. There are 10 species in the family Remizidae. They are similar to true tits, but make characteristic penduline nests. They inhabit open fields and wetlands. They have sharp bill tips and the sexes look alike.A Field Guide to the Birds of Korea. 2005. 06490

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAVONET

Size & morphology13

Beak depth3.8 mm

Beak length (culmen)10.5 mm

Beak length (nares)7.4 mm

Beak width3 mm

Body mass9.3 g

Body mass (female)8.7 g

Body mass (male)9.6 g

Hand-wing index25.2

Kipp's distance14 mm

Secondary length41.5 mm

Tail length43.6 mm

Tarsus length13.1 mm

Wing length55.4 mm

Life cycle & reproduction5

Age at maturity (male)365 days

Age at sexual maturity365 days

Egg mass0.95 g

Litter size3.7

Max. longevity84 months

Diet & foraging6

Ground30 %

Invertebrate60 %

Seed40 %

Trophic levelomnivore

Trophic nicheInvertivore

Understory70 %

Habitat & environment4

HabitatWetland

Migration3.0

Primary lifestyleInsessorial

Range size1 388 084 km²

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Remiz consobrinus has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 548 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

567Tmostly conserved

668Avariable

ATGACATTCATCAACCGATGACTATTCTCAACAAACCACAAAGATATCGGCACCCTCTACCTAATTTTCGGCGCATGAGCCGGGATAGTA …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_021641 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND6s-rRNAl-rRNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type10 076 records

Wild obs. + sensor10 070

Museum / vouchered6

Range

Area of Occupancy AOO5 492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 192≤1 km 202≤10 km 71>10 km 34

499 georeferenced · 9 571 without coordinates

Open the mapobservation + sensor10 070

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6

6 georeferenced

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berkeley, US	5
Ann Arbor, US	1

2 institutions · 6 of 6 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Remiz consobrinus

At a glance

Sources6 archives

Size & morphology13

Life cycle & reproduction5

Diet & foraging6

Habitat & environment4

At a glance

Record type10 076 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 2 geolocated

Record type10 076 records