Reichlingia leopoldii

Diederich & Scheid. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Arthoniomycetes/Arthoniales/Arthoniaceae/Reichlingia

At a glance

Occurrence records323

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Reichlingia leopoldii's data was compiled from.

GBIFGlobal Biodiversity Information Facility323 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF323 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Reichlingia leopoldii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ718047.1 ↗1 438 bpCzech Republic

ACGT

AAGTCGTAACAAGGTTTCTGCCCGGCGTTAGCCGGGGGATGTTCATCCTTCCTGCGGGAGCACCTATTGAAGCCTTCAAAAGCACACTCT …

Reichlingia leopoldii voucher PRA-Vondrak24959 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type323 records

Wild obs. + sensor202

Museum / vouchered121

Range

Area of Occupancy AOO852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 68≤1 km 16≤10 km 90>10 km 1

175 georeferenced · 27 without coordinates

Open the mapobservation + sensor202

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 26≤1 km 10≤10 km 20

56 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence121

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Gdansklocation not on record	34
Philadelphia, US	19
Metsähallituslocation not on record	11
Helsinki, FI	9
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	6
SLU Artdatabankenlocation not on record	5
LDlocation not on record	4
Uppsala, SE	4
CJBGlocation not on record	3
Bergen, NO	2
Berlin, DE	2
Durham, US	1
Bronx, US	1
ASUlocation not on record	1

14 institutions · 102 of 121 vouchered records shown · 19 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)