Ranunculus aquatilis
speciesAt a glance
Occurrence records46 190
Data sources16
Biological traits45
DNA specimens45
eDNA detections24
Sources16 archives
Databases and archives Ranunculus aquatilis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility46 180 records↗
OBISOcean Biodiversity Information System7 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics45 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources45 traits
Chemical compositionLOTUS5 compounds
Occurrence & distributionGBIF · OBIS · PBDB46 190 records
Environmental DNA1 datasets · 7 countries24 detections
DNA & barcodingBOLD · NCBI45 specimens
Genome at a glanceCCDB · GoaT2n = 32
Deep timePBDB3 fossils
01Narrative
La renoncule aquatique est une espèce de plantes à fleurs de la famille des Renonculacées. C'est une plante herbacée vivace ayant une répartition holarctique. Ses tiges et ses feuilles forment des tapis à la surface des eaux stagnantes, qui sont son habitat de prédilection. Elle possède des fleurs blanches à cœurs jaunes qui fleurissent de mai à juillet. Elle vit à une profondeur de 60 centimètres environ.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass5.36 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 160 mm² · GIFT: 143 mm²
Plant height0.02 m
⚠ sources differ — GIFT: 0.02 m · LEDA: 0.02 m · TRY: 0.785 m
Plant height generative0.1 m
Plant height max3 m
Plant height min0.1 m
Seed length1.8 mm
Seed mass0.279 mg
⚠ sources differ — TRY: 0.279 mg · GIFT: 0.3 mg
Seed mass max0.372 mg
Seed mass min0.263 mg
Life cycle & reproduction15
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: hydrochorous
Flowering endAug
Flowering startMay
Life formhydrosubshrub
Life spanannual
⚠ sources differ — TRY: Annual · LEDA: perennials · GIFT: perennial
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Reproduction asexualabsent
Seed number44 238
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticaquatic
Climatetemperate
Climberself-supporting
Elevation max4 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · TRY: hydrophyte
Habitat GIFTcanals, lakes, rivers
Mycorrhiza type0.000327111
Woodinessnon-woody
Physiology & chemistry6
Leaf c419 mg/g
Leaf dry-matter content (LDMC)149 mg/g
⚠ sources differ — TRY: 149 mg/g · LEDA: 125 mg/g
Leaf n52.93 mg/g
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)33.41 mm²/mg
⚠ sources differ — TRY: 33.41 mm²/mg · LEDA: 30.27 mm²/mg · GIFT: 30.76 mm²/mg
Other traits1
Diaspore typegenerative dispersule
03Chemical composition5 compounds
Compounds documented for Ranunculus aquatilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Flavonols5
Documented compounds5 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one | present | LOTUS | |
| quercetin 3-O-sophoroside | present | LOTUS | |
| Quercetin 3-rutinoside | present | LOTUS | |
| Quercetin 3-rutinoside-7-glucoside | present | LOTUS | |
| Quercetin 3-sophoroside-7-glucoside | present | LOTUS |
05DNA & barcoding45 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ranunculus aquatilis has left across the world's sequence archives.
At a glance
DNA specimens45
Marker genes6
GenBank sequences10
eDNA detections24
Countries8
The DNA barcodea real sequence read deposited for this species
AAGGATCATTGTCGAAACCTGCAAAGCAGACGACCCGCGAACATGTTAAAAAGTACCTTGCGGATTGGTGAAGGGTGCGAGCCCCGATCC …
Ranunculus aquatilis isolate HU-20-7 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★rbcLa★trnL-F★ITS9★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Ranunculus aquatilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidypolyploid inferred
Chromosome records16–482n range32median32mode124records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3265×CCDB · slov-fl · CCDB · brit-fl · CCDB · iber-fl +15
CCDB · slov-fl — Murín A. & Májovský J., 1978: [Report], pp. 376-378. - In: Löve Á. (ed.), IOPB chromosome number reports LXI, Taxon 27 /4.
CCDB · brit-fl — Cook, C.D.K. Watsonia 5: 123-126 (1962)
CCDB · brit-fl — Webster, S.D. Watsonia 16: 25-30 (1986)
CCDB · iber-fl — Nmeros cromosomticos de algunas especies acuticas de Ranunculus L. y Callitriche en Asturias. Fernndez Bernaldo de Quirs, C.Rev. Biol.5: 65-70(1987).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1656
CCDB · fl-europaea — Cook, 1962
CCDB · poland — Tura?a K. 1969. Cyto-taxonomical studies in Ranunculus subgenus Batrachium (DC.) A. Gray from Poland. Acta Biol. Cracov. Ser. Bot. 12, 9-20.
CCDB · poland — Skali?ska M., Piotrowicz M., Soko?owska-Kulczycka A. et al. 1961. Further additions to chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 30, 463-489.
CCDB · book-ipcn65 — Love & Love 1965d
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1988. Chromosome numbers in some species of Asparagaceae, Asteraceae and Ranunculaceae from the north Urals (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 73: 605–607.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
CCDB · ipcn-api-dl — Malakha, E. V. 1990. Chromosome numbers in some species of the genera Ranunculus and Batrachium (Ranunculaceae) from the flora of the Soviet far east. Bot. Žhurn. (Moscow & Leningrad) 75: 121–122.
CCDB · ipcn-api-dl — Briggs, B. G., E. Edgar, K. L. Wilson & R. Snow. 2002. Chromosome numbers of some native and naturalised plant species in Australia. Telopea 9: 833–835.
CCDB · ipcn-api-dl — Moore, D. M. 1981. Cromosome numbers of Fuegian angiosperms. Bol. Soc. Brot. 53: 995–1012.
CCDB · ipcn-api-dl — Dahlgren, G. & N. Cronberg. 1996. Species differentiation and relationships in Ranunculus subgenus Batrachium (Ranunculaceae) elucidated by isozyme electrophoresis. Symb. Bot. Upsal. 31(3): 91–104.
CCDB · ipcn-api-dl — Davlianidze, M. 1980. Numeri chromosomatum Angiospermarum Khromosomnye chisla cvetRovykh rastenij. Not. Syst. Geogr. Inst. Bot. Akad. Nauk. Gruzinsk. (Tbilisi). 36: 75–76.
CCDB · ipcn-api-dl — Wittmann, H. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Pilsl, P., H. Wittmann & G. Nowotny. 2002. Beiträge zur Flora des Bundeslandes Salzburg III. Linzer Biol. Beitr. 34(1): 5–165.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Krahulcová, A. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Fernández Bernaldo de Quirós, C. 1987. Números cromosomáticos de algunas especies acuáticas de Ranunculus L. y Callitriche en Asturias. Revista Biol. Univ. Oviedo 5: 65–70.
CCDB · ipcn-api-dl — Dahlgren, G. 1993. Ranunculus penicillatus in Norden. Nordic J. Bot. 13: 593–605.
CCDB · book-ipcn66 — Cook 1966b
CCDB · book-ipcn67-71 — ZHUKOVA, P.G., & V.V. PETROVSKY. 1971. Chromosome numbers of certain flowering plants of the Wrangel island. (In Russian). Bot. Zurn. 56: 294-305.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — MULLIGAN, G.A., & A.E. PORSILD. 1969. Chromosome numbers of some plants from the unglaciated central Yukon plateau, Canada. Canad. J. Bot. 47: 655-662.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.
CCDB · book-ipcn67-71 — TURALA, K. 1969. Cyto-taxonomical studies in Ranunculus subgenus Batrachium (DC.) A. Gray from Poland. Acta Biol. Cracov. Ser. Bot. 12: 9-20.
CCDB · book-ipcn67-71 — SKALINSKA, M., A. JANKUN, H. WCISLO ET AL. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov., Ser. Bot. 14: 55-102.
CCDB · book-ipcn75-78 — Murin & Majovsky 1978
CCDB · book-ipcn75-78 — Murin 1978
CCDB · book-ipcn75-78 — Murin & Zaborsky 1976
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. III Dicotyledons: Salicaceae - Rosaceae. Lagascalia 4: 3-32.
CCDB · book-ipcn73-74 — GOEPFERT, D. 1974. Karyotypes and DNA content in species of Ranunculus L. and related genera. Bot. Notiser 127: 464-489.
CCDB · book-fedorov — CoKoJioscKan, CTpeJIKOBa 1940, 19486
CCDB · book-fedorov — AJteKcaHAPOBa T. B. 1967 bo
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Sorensen 1955
CCDB · book-fedorov — Cook C. D. 1962
CCDB · book-atlas-flowering-plants — B0cher 1932
+10 more references
2n 1632×CCDB · ita-fl · CCDB · iapt · CCDB · iber-fl +6
CCDB · ita-fl — FERRARELLA A., GRISAFI F., LENTINI F., MELATI M.R. - 1983 (1981). Numeri cromosomici per la flora italiana:860-867.. Inform. Bot. Ital. , 13(2-3): 189-194.
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · iber-fl — Nmeros cromosomticos de algunas especies acuticas de Ranunculus L. y Callitriche en Asturias. Fernndez Bernaldo de Quirs, C.Rev. Biol.5: 65-70(1987).
CCDB · iber-fl — Contributions to the karyological study of the genus Ranunculus L. subgenus Batrachium (DC.) A. Gray from the Iberian Peninsula. Diosdado, J. C., J. E. Pastor & B. Valds.Bot. J. Linn. Soc.112: 75-87(1993).
CCDB · mediterranean
CCDB · ipcn-api-dl — Fernández Bernaldo de Quirós, C. 1987. Números cromosomáticos de algunas especies acuáticas de Ranunculus L. y Callitriche en Asturias. Revista Biol. Univ. Oviedo 5: 65–70.
CCDB · ipcn-api-dl — Ferrarella, A., F. Grisafi, F. Lentini & M. R. Melati. 1981. Numeri cromosomici per la Flora Italiana: 860-867. Inform. Bot. Ital. 13: 189–194.
CCDB · ipcn-api-dl — Marcucci. 2005. Mediterranean chromosome number reports 15 (1415--1427). Fl. Medit. 15: 694–702.
CCDB · ipcn-api-dl — Diosdado, J. C. & J. E. Pastor. 1996. Consideraciones citotaxonómicas del género Ranunculus L. (Ranunculaceae) en la Península Ibérica. Anales Jard. Bot. Madrid 54: 166–178.
CCDB · ipcn-api-dl — Diosdado, J. C., J. E. Pastor & B. Valdes. 1993. Contributions to the karyological study of the genus Ranunculus L. subgenus Batrachium (DC.) A. Gray from the Iberian Peninsula. Bot. J. Linn. Soc. 112: 75–87.
CCDB · book-ipcn66 — Cook 1966b
CCDB · book-ipcn73-74 — SCOTT, P.J. 1974. In IOPB chromosome number reports XLIII. Taxon 23: 193-196.
CCDB · book-ipcn73-74 — GOEPFERT, D. 1974. Karyotypes and DNA content in species of Ranunculus L. and related genera. Bot. Notiser 127: 464-489.
CCDB · eflora
CCDB · CromoCat 2015 — Scott, P. J. (1974). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIII]. Taxon 23(1): 194-195.
CCDB · CromoCat 2015 — Cook, C. D. K. (1966). A monographic study of Ranunculus subgenus Batrachium (DC.) A. Gray. Mitt. Bot. Staatssamml. München 6: 47-237.
CCDB · CromoCat 2015 — Fernández Bernaldo de Quirós, C. (1987). Números cromosomáticos de algunas especies acuáticas de Ranunculus L. y Callitriche en Asturias. Rev. Biol. 5: 65-70.
CCDB · CromoCat 2015 — Ferrarella, A., Grisafi, F. Lentini, F. & Melati, M. R. (1981). Numeri cromosomici per la flora italiana, 860-867. Inf. Bot. Ital. 13: 189-194.
CCDB · CromoCat 2015 — Goepfert, D. (1974). Karyotypes and DNA content in species of Ranunculus L. and related genera. Bot. Not. 127: 464-489.
CCDB · CromoCat 2015 — Kerguélen, M. (1998). Index synonymique de la Flore de France INRA-MNHN Dijon
CCDB · CromoCat 2015 — Diosdado, J. C. & Pastor, J. E. (1996). Consideraciones citotaxonómicas del género Ranunculus L. (Ranunculaceae) en la Peninsula Ibérica Anales Jard. Bot. Madrid 54(1): 166-178.
CCDB · CromoCat 2015 — Diosdado, J. C., Pastor, J. E. & Valdés, B. (1993c). Contributions to the karyological study of the genus Ranunculus L. subgenus Batrachium (DC.) A. Gray from the Iberian Peninsula. Bot. J. Linn. Soc. 112: 75-87.
CCDB · iapt — IAPT/IOPB Chromosome Data 27
2n 4825×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +11
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · brit-fl — Cook, C.D.K. Mitt. Bot. Staatssamml. München 6: 47-237 (1966)
CCDB · brit-fl — Cook, C.D.K. Watsonia 5: 123-126 (1962)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1658
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1659
CCDB · fl-europaea — Cook, 1962
CCDB · poland — Tura?a K. 1969. Cyto-taxonomical studies in Ranunculus subgenus Batrachium (DC.) A. Gray from Poland. Acta Biol. Cracov. Ser. Bot. 12, 9-20.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 2002. Chromosome numbers of Ranunculaceae species of the Byelorussian flora. Bot. Žhurn. (Moscow & Leningrad) 87(11): 131–133.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
CCDB · ipcn-api-dl — Dahlgren, G. & N. Cronberg. 1996. Species differentiation and relationships in Ranunculus subgenus Batrachium (Ranunculaceae) elucidated by isozyme electrophoresis. Symb. Bot. Upsal. 31(3): 91–104.
CCDB · book-ipcn66 — Cook 1966b
CCDB · book-ipcn67-71 — TURALA, K. 1969. Cyto-taxonomical studies in Ranunculus subgenus Batrachium (DC.) A. Gray from Poland. Acta Biol. Cracov. Ser. Bot. 12: 9-20.
CCDB · book-ipcn67-71 — SKALINSKA, M., A. JANKUN, H. WCISLO ET AL. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov., Ser. Bot. 14: 55-102.
CCDB · book-ipcn75-78 — Murin 1978
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. III Dicotyledons: Salicaceae - Rosaceae. Lagascalia 4: 3-32.
CCDB · book-ipcn73-74 — GOEPFERT, D. 1974. Karyotypes and DNA content in species of Ranunculus L. and related genera. Bot. Notiser 127: 464-489.
CCDB · eflora
CCDB · Cave1956supp — Sorensen 1955
CCDB · CromoCat 2015 — Cook, C.D.K., Grau, J. & López González, G. (1986). Ranunculus L. In S.Castroviejo et al (eds), Flora Iberica 1: 279-371 RJBM-CSIC Madrid
CCDB · CromoCat 2015 — Dahlgren, G. & Cronberg, N. (1996). Species differentiation an relationships in Ranunculus subgenus Batrachium (Ranunculaceae) elucidated by isozyme electrophoresis. Symb. Bot. Upsal. 31(3):91-104
CCDB · CromoCat 2015 — Cook, C. D. K. (1966). A monographic study of Ranunculus subgenus Batrachium (DC.) A. Gray. Mitt. Bot. Staatssamml. München 6: 47-237.
CCDB · CromoCat 2015 — Dahlgren, G. (1991). Karyological investigations in Ranunculus subg. Batrachium (Ranunculaceae) on the Aegean Islands. Pl. Syst. Evol. 177:193-211
2n 241×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Zhukova et al. 1977a
2n 401×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Dahlgren, G. (1991). Karyological investigations in Ranunculus subg. Batrachium (Ranunculaceae) on the Aegean Islands. Pl. Syst. Evol. 177:193-211
n 820×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Contributions to the karyological study of the genus Ranunculus L. subgenus Batrachium (DC.) A. Gray from the Iberian Peninsula. Diosdado, J. C., J. E. Pastor & B. Valds.Bot. J. Linn. Soc.112: 75-87(1993).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 592-602. Silvestre, S.Lagascalia15(2): 283-288(1990).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 464-470. Gallego Cidoncha, M. J.Lagascalia14(2): 286-288(1986).
CCDB · ipcn-api-dl — Silvestre, S. 1990. Números cromosómicos para la flora Española. 592--602. Lagascalia 15: 283–288.
CCDB · ipcn-api-dl — Diosdado, J. C. & J. E. Pastor. 1996. Consideraciones citotaxonómicas del género Ranunculus L. (Ranunculaceae) en la Península Ibérica. Anales Jard. Bot. Madrid 54: 166–178.
CCDB · ipcn-api-dl — Diosdado, J. C., J. E. Pastor & B. Valdes. 1993. Contributions to the karyological study of the genus Ranunculus L. subgenus Batrachium (DC.) A. Gray from the Iberian Peninsula. Bot. J. Linn. Soc. 112: 75–87.
CCDB · ipcn-api-dl — Pizarro, J. 1995. Contribucio|3n al estudio taxono|3mico de Ranunculus L. subgen. Batrachium (DC.) A. Gray (Ranunculaceae). Lazaroa 15: 21–113.
CCDB · CromoCat 2015 — Silvestre, S. (1990). Números cromosómicos para la flora española. 592-602. Lagascalia 15(2): 283-288.
CCDB · CromoCat 2015 — Diosdado, J. C., Pastor, J. E. & Valdés, B. (1993c). Contributions to the karyological study of the genus Ranunculus L. subgenus Batrachium (DC.) A. Gray from the Iberian Peninsula. Bot. J. Linn. Soc. 112: 75-87.
CCDB · CromoCat 2015 — Diosdado, J. C. & Pastor, J. E. (1996). Consideraciones citotaxonómicas del género Ranunculus L. (Ranunculaceae) en la Peninsula Ibérica Anales Jard. Bot. Madrid 54(1): 166-178.
n 168×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · iber-fl — Contributions to the karyological study of the genus Ranunculus L. subgenus Batrachium (DC.) A. Gray from the Iberian Peninsula. Diosdado, J. C., J. E. Pastor & B. Valds.Bot. J. Linn. Soc.112: 75-87(1993).
CCDB · ipcn-api-dl — De Montmollin, B. 1984. Etude cytotaxonomique de la flore de la Crète. II. Nombres chromosomiques. Bot. Helv. 94: 261–267.
CCDB · ipcn-api-dl — Pizarro, J. 1995. Contribucio|3n al estudio taxono|3mico de Ranunculus L. subgen. Batrachium (DC.) A. Gray (Ranunculaceae). Lazaroa 15: 21–113.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · CromoCat 2015 — Dahlgren, G. (1991). Karyological investigations in Ranunculus subg. Batrachium (Ranunculaceae) on the Aegean Islands. Pl. Syst. Evol. 177:193-211
CCDB · CromoCat 2015 — Montmollin, B. de. (1984). Étude cytotaxonomique de la flore de la Crète. II. Nombres chromosomiques. Ber. Schweiz. Bot. Ges. (Bull. Soc. Bot. Suisse) 94: 261-267.
CCDB · CromoCat 2015 — Diosdado, J. C. & Pastor, J. E. (1996). Consideraciones citotaxonómicas del género Ranunculus L. (Ranunculaceae) en la Peninsula Ibérica Anales Jard. Bot. Madrid 54(1): 166-178.
CCDB · CromoCat 2015 — Diosdado, J. C., Pastor, J. E. & Valdés, B. (1993c). Contributions to the karyological study of the genus Ranunculus L. subgenus Batrachium (DC.) A. Gray from the Iberian Peninsula. Bot. J. Linn. Soc. 112: 75-87.
n 321×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Dahlgren, G. (1991). Karyological investigations in Ranunculus subg. Batrachium (Ranunculaceae) on the Aegean Islands. Pl. Syst. Evol. 177:193-211
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
07Deep time23–0.01 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range23–0.01 Ma Oligocene → Pleistocene
Dated fossil finds3
StatusStill living record runs to the present
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Ranunculus aquatilis. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type46 190 records
Wild obs. + sensor41 433
Museum / vouchered4 632
Cultivated / captive40
Fossil7
Other78
Origin
Native7 609
Introduced5
Range
Area of Occupancy AOO82 708 km²
Depth
0–200 m sunlit6
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 1.8 m · max 3.3 m · 6 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy45% within 1 km
≤100 m 6 122≤1 km 10 780≤10 km 20 752>10 km 167
37 821 georeferenced · 3 612 without coordinates
Open the mapobservation + sensor41 433
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy59% within 1 km
≤100 m 597≤1 km 876≤10 km 911>10 km 102
2 486 georeferenced · 2 146 without coordinates
Open the institutions mapphysical evidence4 632
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 36
37 georeferenced · 3 without coordinates
Open the mapnot free-living40
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions130 of 231 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 621 |
| MeiseBGlocation not on record | 277 |
| DBF-NHMDlocation not on record | 262 |
| Olocation not on record | 160 |
| Tartu, EE | 151 |
| Oskarshamn, SE | 145 |
| Uniwersytet Wrocławskilocation not on record | 140 |
| SLU Artdatabankenlocation not on record | 134 |
| Missoula, US | 110 |
| Turku, FI | 99 |
| ASUlocation not on record | 79 |
| TUR-Alocation not on record | 75 |
| BRNUlocation not on record | 72 |
| South Kensington, GB | 69 |
| Museo Entomologico de Leonlocation not on record | 64 |
| Entomological Society of Latvialocation not on record | 62 |
| Trondheim, NO | 59 |
| Adam Mickiewicz University in Poznańlocation not on record | 58 |
| Salzburg, AT | 57 |
| Tallinn, EE | 57 |
| Victoria, CA | 49 |
| Moscow, US | 49 |
| BFLlocation not on record | 40 |
| WTUlocation not on record | 33 |
| Denver, US | 32 |
| Bronx, US | 31 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 31 |
| Green Bay, US | 26 |
| Québec, CA | 26 |
| Riverside, US | 25 |
| Oulu, FI | 24 |
| Uppsala, SE | 24 |
| Bozeman, US | 24 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 24 |
| Pullman, US | 24 |
| GJOlocation not on record | 23 |
| Brussel, BE | 23 |
| Flagstaff, US | 23 |
| Moscow State Universitylocation not on record | 22 |
| Kuopio, FI | 22 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 20 |
| GZUlocation not on record | 20 |
| BClocation not on record | 19 |
| Bergen, NO | 19 |
| St. Paul, US | 18 |
| CJBGlocation not on record | 18 |
| Davis, US | 17 |
| Boise, US | 17 |
| TROMlocation not on record | 17 |
| València, ES | 17 |
| Spearfish, US | 16 |
| University of Alberta Museumslocation not on record | 16 |
| Albuquerque, US | 16 |
| Salamanca, ES | 16 |
| DOI/NPS, Greenbelt Parklocation not on record | 16 |
| Valparaiso, CL | 16 |
| Museo Achille Folettolocation not on record | 15 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 15 |
| Barcelona, ES | 14 |
| Montréal, CA | 14 |
| Uniwersytet Jagiellońskilocation not on record | 14 |
| Provincia di Livornolocation not on record | 13 |
| MAlocation not on record | 13 |
| Whitewater, US | 13 |
| Bourges, FR | 13 |
| Philadelphia, US | 12 |
| UIBlocation not on record | 12 |
| Vitoria, ES | 12 |
| San Luis Obispo, US | 11 |
| Pocatello, US | 11 |
| Madison, US | 11 |
| University of Birminghamlocation not on record | 10 |
| EL PASO, US | 10 |
| Dresden, DE | 10 |
| Phoenix, US | 10 |
| BDBClocation not on record | 10 |
| BSBIlocation not on record | 10 |
| Görlitz, DE | 9 |
| New Haven, US | 9 |
| San Diego, US | 9 |
| Mexico City, MX | 9 |
| Chongqing Museumlocation not on record | 9 |
| Canadian Department of Agriculturelocation not on record | 9 |
| Bern, CH | 8 |
| Davenport, US | 8 |
| Austin, US | 8 |
| Porrentruy, CH | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| Saint Louis, US | 7 |
| Paris, FR | 6 |
| IDElocation not on record | 6 |
| Logan, US | 6 |
| Toronto, CA | 6 |
| Tampa, US | 6 |
| Auckland, NZ | 6 |
| CASlocation not on record | 6 |
| Portland, US | 6 |
| Corvallis, US | 6 |
| Podgorica, ME | 6 |
| Tacoma, US | 6 |
| Knoxville, US | 6 |
| Uniwersytet Warszawskilocation not on record | 6 |
| Yukon Universitylocation not on record | 5 |
| KMNlocation not on record | 5 |
| University of Lethbridgelocation not on record | 5 |
| Philadelphia, US | 5 |
| Durango, MX | 5 |
| Université Lavallocation not on record | 5 |
| UGentlocation not on record | 5 |
| San Angelo, US | 5 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| LfUlocation not on record | 5 |
| JBSlocation not on record | 5 |
| Fullerton, US | 5 |
| Vancouver, CA | 5 |
| Claremont, US | 5 |
| Los Angeles, US | 4 |
| Cheney, US | 4 |
| Wellington, NZ | 4 |
| Mlocation not on record | 4 |
| USFSlocation not on record | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Arcata, US | 4 |
| Emporia, US | 4 |
| Tilburg, NL | 4 |
| Provo, US | 4 |
| Guangzhou, CN | 4 |
| The Manitoba Museum, Botany Departmentlocation not on record | 4 |
| Portland, US | 4 |
| Caldwell, US | 4 |
| Royal Botanic Garden Edinburghlocation not on record | 4 |
| NMBU:MINAlocation not on record | 4 |
| Pamplona, ES | 3 |
| Nijmegen, NL | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| US | 3 |
| Staten Island, US | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Kew, GB | 3 |
| BIO-UNIPIlocation not on record | 3 |
| Fredericton Stock Culture Collectionlocation not on record | 3 |
| Columbia, US | 3 |
| Wuzhou, CN | 3 |
| Boumlocation not on record | 3 |
| Severin-McDaniel Insect Collectionlocation not on record | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Göteborg, SE | 3 |
| Sevilla, ES | 3 |
| Frankfurt am Main | 3 |
| Whitehorse, CA | 3 |
| Sion, CH | 3 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| The University of Arizonalocation not on record | 2 |
| BG-NMNHSlocation not on record | 2 |
| Hermosillo, MX | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| WINlocation not on record | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Santa Cruz, US | 2 |
| National Museum Waleslocation not on record | 2 |
| Nanjing, CN | 2 |
| Santa Barbara, US | 2 |
| Wlocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Alicante, ES | 2 |
| Granada, ES | 2 |
| Berlin, DE | 2 |
| Madrid, ES | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 2 |
| PRClocation not on record | 2 |
| Portland, US | 2 |
| Pittsburg, US | 2 |
| US | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Ashland, US | 1 |
| US | 1 |
| DULlocation not on record | 1 |
| Clemson, US | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 1 |
| Ensenada, MX | 1 |
| Oswego, US | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Williamsburg, US | 1 |
| Irvine, US | 1 |
| Orem, US | 1 |
| Hobart, AU | 1 |
| Chapel Hill, US | 1 |
| Universität Erlangen-Nürnberglocation not on record | 1 |
| H-Meierottlocation not on record | 1 |
| Beijing, CN | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Truckee, US | 1 |
| INFlocation not on record | 1 |
| Anchorage, US | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Durham, US | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| Ann Arbor, US | 1 |
| Mexico City, MX | 1 |
| Weber State Universitylocation not on record | 1 |
| Lausanne, CH | 1 |
| Churchill Northern Studies Centrelocation not on record | 1 |
| Macomb, US | 1 |
| FLADlocation not on record | 1 |
| Canadian Museum of Naturelocation not on record | 1 |
| Baroda, IN | 1 |
| Saint John, CA | 1 |
| Northridge, US | 1 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Dekalb, US | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| H-Diewaldlocation not on record | 1 |
| Pretoria, ZA | 1 |
| Grand Junction, US | 1 |
| Durango, US | 1 |
| Winterthur, CH | 1 |
| No collectionlocation not on record | 1 |
| Cambridge, US | 1 |
| Jyväskylä, FI | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Millersville, US | 1 |
| SZUlocation not on record | 1 |
231 institutions · 4 331 of 4 632 vouchered records shown · 292 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA24 detections
Where the DNA of Ranunculus aquatilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map7 countries0
Marsh in a small shallow depression within t…streamOak Woodland and surrounding Chaparral with …Dry, open grassland with Agropyron triticeum…wide water ditchdeep water
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.9 °C 8.20–16.0
Seasonal swing summer↔winter15.1 °C
Max temp (day)17.8 °C 12.4–20.5
Min temp (night)8.70 °C 4.60–12.4
Precipitation81.8 mm/mo 48.3–145
Air humidity60.9 % 57.7–64.3
Moisture balance-13.8 mm/mo -70.9–39.0
Vapour deficit628 Pa 429–746
Wind speed3.30 m/s 2.50–5.40
Cloud cover41.5 % 20.8–55.1
CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.